Саньенг кайрон габариты: Технические характеристики SsangYong Kyron / СангЙонг Кайрон

(3) 1998 2295 Диаметр цилиндра и ход поршня, мм 86,2 x 85,6 90,9 x 88,4 Максимальная мощность, кВт (л.с.) при об/мин 104 (141)/ 4 000 110 (150)/ 5 500 Максимальный крутящий момент, Нм при об/мин 310/ 1 800 — 2 750 214/ 3 500 — 4 000 Степень сжатия 17,5:1 10,4 : 1 Система подачи топлива Впрыск топлива под давлением Распределенный впрыск топлива с электронным управлением Трансмиссия Коробка передач 5-ти ступенчатая механическая 6-ти ступенчатая автоматическая КП T-Tronic с возможностью ручного переключения передач 5-ти ступенчатая механическая 6-ти ступенчатая автоматическая КП T-Tronic с возможностью ручного переключения передач Передаточное отношение на 1-й 4,315 3,536 4,315 3,536 на 2 передаче 2,475 2,143 2,475 2,143 на 3 передаче 1,536 1,478 1,536 1,478 на 4 передаче 1 1,156 1 1,156 на 5 передаче 0,807 0,866 0,807 0,866 на 6 передаче — 0,667 — 0,667 задняя 3,919 3,094 3,919 3,094 Передаточное отношение раздаточной коробки 1:1 — 2H/4H;
2. 483:1 — 4L Передаточное отношение главной передачи (передние/ задние колеса) 4,27 Тип привода Система подключаемого полного привода (Part-Time) Шасси Передняя подвеска Независимая, пружинная, рычажная, с гидравлическими телескопическими амортизаторами, со стабилизатором поперечной устойчивости Задняя подвеска Зависимая, пружинная, с гидравлическими телескопическими амортизаторами, со стабилизатором поперечной устойчивости Рулевой механизм Шестерня-рейка с гидроусилителем Тормозная система (Передняя ось/ задняя ось) Дисковые вентилируемые/ дисковые Колесные диски 16″ x 6.5J Шины 235/75R16 Массогабаритные показатели Снаряженная масса, кг 1 878 — 1 983 1 905 — 2 010 1 862 — 1 971 1 928 — 2 000 Полная масса, кг 2530 Максимальная нагрузка на переднюю ось, кг 1 205 — 1 230 1 179 — 1 202 Максимальная нагрузка на заднюю ось, кг 1 300 — 1 325 1 328 — 1 351 Максимальная масса буксируемого прицепа (с тормозами), кг 2300 2100 2300 (без тормозов), кг 750 Габаритная длина, мм 4660 Габаритная ширина, мм 1880 Габаритная высота (с рейлингами на крыше), мм 1 740 (1 755) Колесная база, мм 2740 Колея передних колес, мм 1570 Колея задних колес, мм 1570 Высота от сидений до крыши (1-ый ряд), мм 1019 Ширина салона на уровне плеч (1-ый ряд), мм 1506 Ширина салона на уровне бедер (1-ый ряд), мм 1421 Пространство для ног, мм 1059 Объем багажного отделения, л 625 Объем топливного бака, л 75 Характеристики Расход топлива*: Городской цикл, л/100 км 9,9 10,6 14,9 н. д. Загородный цикл, л/100 км 6,3 7,1 8,7 н.д. Комбинированный цикл, л/100 км 7,7 8,4 11 н.д. Максимальная скорость, км/ч 167 166 167 170 Разгон до сотни 14,2 10,6 14,2 14,8 Диаметр разворота, м 11,2 Угол въезда/ Угол съезда, град. 26/ 23 Угол продольной проходимости, град. 21 н.д. Минимальный дорожный просвет (передняя ось/ задняя ось), мм 210/ 199

Двигатель

Особое значение для внедорожников приобретают такие характеристики двигателей, как надежность, мощность и неприхотливость. Именно их и удалось достичь создателям SsangYong Kyron. Предлагаемые комплектации подразумевают оснащение автомобиля 4-х тактными двигателями, работающими как на бензине, так и на дизельном топливе.

Дизели объемом 2.0 л имеют мощность, равную 141 л.с., бензиновые моторы несколько мощнее – при объеме 2.3 л их максимум – 150 л.с. Оба варианта двигателей отлично справляются с поставленными перед ними задачами и успешно разгоняют до нужной скорости внедорожник весом свыше 1500 кг. Максимальный крутящий момент, достигающий соответственно 310 и 214 Нм, позволяет SsangYong Kyron стать еще более стремительным и напористым.

Благодаря инновационной системе подачи топлива удалось достичь максимальной экономичности Kyron. В бензиновых двигателях осуществляется электронное управление распределенным впрыском топлива, в дизелях он происходит под давлением.

Содержание

Трансмиссия

Оба варианта двигателей могут оснащаться 5-ти ступенчатыми механическими КП или 6-ти ступенчатыми коробками-автоматами T-Tronic, предоставляющими возможность переключения передач вручную. Система подключаемого полного привода Part-Time позволяет водителю самостоятельно контролировать процесс отключения переднего моста в момент передвижения по дороге с твердым покрытием.

Шасси

Внедорожники Kyron отлично приспособлены для движения в различных условиях, что особенно актуально в России, где качество большей части дорожного покрытия оставляет желать лучшего.

Независимая пружинная передняя подвеска, а также зависимая задняя подвеска, оснащенные гидравлическими телескопическими амортизаторами и стабилизаторами поперечной устойчивости, обеспечивают максимальную стабильность курса в процессе езды даже по самым сложным трассам.

16-ти дюймовые легкосплавные диски, обутые в резину 235/75R16, позволяют легко преодолевать даже самые серьезные дорожные неровности и гарантируют комфортную поездку в любых условиях.

Массогабаритные показатели

В зависимости от комплектации снаряженная масса внедорожника может колебаться в пределах 1862-2010 кг. Передняя ось выдерживает нагрузку до 1230 кг, задняя – до 1351 кг. Имеющиеся мощности позволяют Kyron буксировать прицеп, вес которого не превышает 2300 кг.

Несмотря на внушительные габариты: длину – 4660, ширину – 1880 и высоту – 1740 мм внедорожник отличается правильностью и гармоничностью пропорций. Ширина салона, на уровне плеч составляющая 1506 мм, гарантирует комфортное размещение пассажиров и удобство путешествия на значительные расстояния.

Вместительное багажное отделение с объемом 625 л позволяет осуществлять перевозку довольно габаритных грузов. Кроме того, часть их можно перемещать на крыше, где специально для этого установлены рейлинги, доступные в большинстве комплектаций.

Топливный бак имеет вместимость до 75 л, что гарантирует возможность длительного путешествия без частых остановок для дозаправки. Средний расход топлива, заявленный производителем, составляет 9,9-14,9 л/100 км в городе и 6,3-8,7 л/100 км за его пределами. До максимальной скорости 170 км/ч внедорожник способен разогнаться за 14,8 с.

В зависимости от комплектации Ssang Yong Kyron могут быть оснащены:

  • ESP – системой курсовой устойчивости;
  • BAS – системой помощи во время экстренного торможения;
  • ARP – защитой от опрокидывания;
  • HDC – системой контроля спуска со склона;
  • передними и боковыми подушками безопасности;
  • системой блокировки дверных замков;
  • системой оповещения о препятствиях сзади.

Заявленный расход топлива для дизельного двигателя составляет 8 л, для бензинового —  12 л на 100 км пробега. Максимально развиваемая скорость соответственно равна 166 и 170 км/ч. Благодаря широкой низкопрофильной резине СанЕнг Кайрона обеспечивается отличное сцепление колеса с грунтом.

Технико-эксплуатационные характеристики корейского кроссовера только подтверждают его универсальность, великолепную управляемость, непревзойденную мощность и безупречную функциональность. Благодаря гарантированной комфортности, экономичности, динамичности и удобству SsangYong Kyron является отличным решением для людей, не мыслящих свою жизнь без автомобиля.

Кайрон технические характеристики, SsangYong Kyron технические характеристики, СанЕнг Кайрон технические характеристики.


Цены указаны за автомобиль соответствующей комплектации белого цвета. Представленные на сайте данные о комплектациях, технических характеристиках, цветовой гамме, стоимости автомобилей SsangYong и их сервисного обслуживания носят общий информационный характер и не являются публичной офертой, определяемой положениями Статьи 437 (2) Гражданского кодекса Российской Федерации. Самую последнюю и подробную информацию вы можете получить у наших менеджеров.

Технические характеристики SsangYong Kyron

Описание автомобиля SsangYong Kyron

Ссанг Енг Кайрон — внедорожник, выпускаемый  с 2005 года. Модель разработана так же, как Actyon, отличается внешним видом и оформлением интерьера. Здесь есть все, чтобы покорить Вас: стиль, мощность, функциональность. В выпущенной модели отлично сочетаются совершенства от городского типа, комфорт и отличная управляемость от внедорожника и дизайн спортивных машин. Просторный и эргономичный салон, сильные и экономичные двигатели в совмещении с системой полного привода — все, что необходимо для великолепного путешествия, и в это же время Кайрон является идеальным предпочтением для современных жителей мегаполиса.

Запуск в серийное производство SsangYong Kyron состоялся в 2005 году, спустя два года внедорожник был подвергнут модернизации. Данная модель привлекает к себе внимание, прежде всего своей неординарной внешностью исполненной в спортивном стиле, что не характерно для автомобилей подобного класса.

Во фронтальной части транспорта привлекают внимание плавные обводы капота, на котором выполнена стильная сходящаяся к радиаторной решетке штамповка. Блоки основного света и дневные ходовые огни гармонично вписаны в окружающие их элементы, такими же естественными переходами обеспеченны колесные арки и боковые плоскости внедорожника. Крыша из-за довольно существенного уклона имеет небольшую высоту в районе кормы. Внутреннее пространство автомобиля отделывается материалами высокого класса темных оттенков. Уже в базовой модификации автопроизводитель обеспечивает кресло водителя сервоприводом, используя который можно отрегулировать величину поясничного упора, настроить положения сиденья, угол наклона спинки. Кроме этого в состав базовой комплектации вошла система позволяющая переключать трансмиссию в особые режимы работы, в процессе управления машиной водителю будут помогать многочисленные высокотехнологичные электронные системы.

Экстерьер

На капоте точка SsangYong образован довольно крутой радиус закругления, крутизна которого еще более увеличивается по мере приближения к фронтальной части Kyron. Выполненные на капоте грани штамповки сходятся к слегка выступающей вперед радиаторной решетке отделанной серебристыми полимерными вставками. Крупные блоки основного света сужаются к своей внутренней боковой грани, совмещают в себе круглые фары и сигналы поворотов идентичной формы. В центре бампера образована закрытая сеткой полоса, предназначенная для забора воздуха к механизмам автомобиля, на боковых поверхностях бампера встроены элементы дневных ходовых огней.

Выпуклые передние арки колес берут свое начало у основания бампера, затем плавно переходят в восходящую штамповку, проходящую над дверными ручками. На дверях в районе кормы выполнена еще одна грань штамповки, кроме этого рельефная поверхность образована в районе порогов. Крыша имеет существенный уклон к корме окна в задней части машины подвергнуты заводской тонировке. Задние фонари ориентированы в горизонтальной плоскости, слегка расширяются навстречу друг другу, на свободном между фонарями пространстве выполнена ниша номерного знака. Кузов имеет габаритные размеры 4660/1880/1755 мм, величина дорожного просвета — 199 миллиметров. На полный разворот внедорожнику требуется диаметр в 11,2 м, снаряженная масса — 1953 кг, полная — 2530 кг, под багажник выделен внушительный объем в 625 литров, база колес — 2740 мм.

Интерьер

Внутренний интерьер SsangYong точно также как и дизайн кузова оформлен в спортивной и стилистике, при отделке внутреннего пространства Kyron автопроизводителем используется качественный пластик и натуральная кожа. В спинку заднего дивана встроен комфортабельный поясничный валик, на сиденье дивана сформированы невысокие валики поддержки. В случае необходимости диван можно легко трансформировать в дополнительный багажный отсек или в спальное место. Передние кресла имеют профиль, при котором образуется всесторонняя, уверенная поддержка тела, причем она не мешает свободный посадки.

Места первого ряда разделены массивным боксом, торцевая часть которого используется под компоновку регулируемых дефлекторов обдува климат-контроля, кроме этого обдув задних пассажирских мест осуществляется через потолочные воздуховоды. К передней части бокса примыкает боковая консоль, оборудованная крупными клавишами включения особых режимов работы трансмиссии, селектором трансмиссии, ручным тормозом и неглубокой нишей накрытой крышкой. Консоль передней панели и приборный щиток, визуально выполненный в единый блок. В состав консоли вошел вертикальный ряд клавиш управления бортовыми системами, средства управления автомагнитолой, климат-контролем, в верхней части консоли сосредоточены регулируемые дефлекторы обдува. На массивную ось руля нанесены дублирующие кнопки управления стерео системой, состав шкаф приборного щитка стандартной.

Технические характеристики

Бензиновая модификация СсангЯнг Кайрон поставлялась с мотором объемом 2295 см3. Он развивает 214 Нм крутящего момента, способен обеспечить крейсерскую скорость в 168 км/час, имеет мощность 150 л. сил. Дизельный вариант машины оснащается 141-сильным агрегатом объемом 1998 см3. Он развивает 310 Нм крутящего момента, предельная скорость 167 км/час, усредненный уровень потребления топлива – 7,7 литров. (3)


1998

2295

Диаметр цилиндра и ход поршня, мм

86,2 x 85,6

90,9 x 88,4

Максимальная мощность, кВт (л.с.) при об/мин

104 (141)/ 4 000

110 (150)/ 5 500

Максимальный крутящий момент, Нм при об/мин

310/ 1 800 — 2 750

214/ 3 500 — 4 000

Степень сжатия

17,5:1

10,4 : 1

Система подачи топлива

Впрыск топлива под давлением

Распределенный впрыск топлива с электронным управлением

Трансмиссия

Коробка передач

5-ти ступенчатая механическая

6-ти ступенчатая автоматическая КП T-Tronic с возможностью ручного переключения передач

5-ти ступенчатая механическая

6-ти ступенчатая автоматическая КП T-Tronic с возможностью ручного переключения передач

Передаточное отношение на 1-й

4,315

3,536

4,315

3,536

на 2 передаче

2,475

2,143

2,475

2,143

на 3 передаче

1,536

1,478

1,536

1,478

на 4 передаче

1

1,156

1

1,156

на 5 передаче

0,807

0,866

0,807

0,866

на 6 передаче

0,667

0,667

задняя

3,919

3,094

3,919

3,094

Передаточное отношение раздаточной коробки

1:1 — 2H/4H;
2. 483:1 — 4L

Передаточное отношение главной передачи (передние/ задние колеса)

4,27

Тип привода

Система подключаемого полного привода (Part-Time)

Шасси

Передняя подвеска

Независимая, пружинная, рычажная, с гидравлическими телескопическими амортизаторами, со стабилизатором поперечной устойчивости

Задняя подвеска

Зависимая, пружинная, с гидравлическими телескопическими амортизаторами, со стабилизатором поперечной устойчивости

Рулевой механизм

Шестерня-рейка с гидроусилителем

Тормозная система (Передняя ось/ задняя ось)

Дисковые вентилируемые/ дисковые

Колесные диски

16″ x 6.5J

Шины

235/75R16

Массогабаритные показатели

Снаряженная масса, кг

1 878 — 1 983

1 905 — 2 010

1 862 — 1 971

1 928 — 2 000

Полная масса, кг

2530

Максимальная нагрузка на переднюю ось, кг

1 205 — 1 230

1 179 — 1 202

Максимальная нагрузка на заднюю ось, кг

1 300 — 1 325

1 328 — 1 351

Максимальная масса буксируемого прицепа (с тормозами), кг

2300

2100

2300

(без тормозов), кг

750

Габаритная длина, мм

4660

Габаритная ширина, мм

1880

Габаритная высота (с рейлингами на крыше), мм

1 740 (1 755)

Колесная база, мм

2740

Колея передних колес, мм

1570

Колея задних колес, мм

1570

Высота от сидений до крыши (1-ый ряд), мм

1019

Ширина салона на уровне плеч (1-ый ряд), мм

1506

Ширина салона на уровне бедер (1-ый ряд), мм

1421

Пространство для ног, мм

1059

Объем багажного отделения, л

625

Объем топливного бака, л

75

Характеристики

Расход топлива*:

Городской цикл, л/100 км

9,9

10,6

14,9

н. д.

Загородный цикл, л/100 км

6,3

7,1

8,7

н.д.

Комбинированный цикл, л/100 км

7,7

8,4

11

н.д.

Максимальная скорость, км/ч

167

166

167

170

Разгон до сотни

14,2

10,6

14,2

14,8

Диаметр разворота, м

11,2

Угол въезда/ Угол съезда, град.

26/ 23

Угол продольной проходимости, град.

21

н.д.

Минимальный дорожный просвет (передняя ось/ задняя ось), мм

210/ 199

Двигатель

Особое значение для внедорожников приобретают такие характеристики двигателей, как надежность, мощность и неприхотливость. Именно их и удалось достичь создателям SsangYong Kyron. Предлагаемые комплектации подразумевают оснащение автомобиля 4-х тактными двигателями, работающими как на бензине, так и на дизельном топливе.

Дизели объемом 2.0 л имеют мощность, равную 141 л.с., бензиновые моторы несколько мощнее – при объеме 2.3 л их максимум – 150 л.с. Оба варианта двигателей отлично справляются с поставленными перед ними задачами и успешно разгоняют до нужной скорости внедорожник весом свыше 1500 кг. Максимальный крутящий момент, достигающий соответственно 310 и 214 Нм, позволяет SsangYong Kyron стать еще более стремительным и напористым.

Благодаря инновационной системе подачи топлива удалось достичь максимальной экономичности Kyron. В бензиновых двигателях осуществляется электронное управление распределенным впрыском топлива, в дизелях он происходит под давлением.

Трансмиссия

Оба варианта двигателей могут оснащаться 5-ти ступенчатыми механическими КП или 6-ти ступенчатыми коробками-автоматами T-Tronic, предоставляющими возможность переключения передач вручную. Система подключаемого полного привода Part-Time позволяет водителю самостоятельно контролировать процесс отключения переднего моста в момент передвижения по дороге с твердым покрытием.

Шасси

Внедорожники Kyron отлично приспособлены для движения в различных условиях, что особенно актуально в России, где качество большей части дорожного покрытия оставляет желать лучшего.

Независимая пружинная передняя подвеска, а также зависимая задняя подвеска, оснащенные гидравлическими телескопическими амортизаторами и стабилизаторами поперечной устойчивости, обеспечивают максимальную стабильность курса в процессе езды даже по самым сложным трассам.

16-ти дюймовые легкосплавные диски, обутые в резину 235/75R16, позволяют легко преодолевать даже самые серьезные дорожные неровности и гарантируют комфортную поездку в любых условиях.

Массогабаритные показатели

В зависимости от комплектации снаряженная масса внедорожника может колебаться в пределах 1862-2010 кг. Передняя ось выдерживает нагрузку до 1230 кг, задняя – до 1351 кг. Имеющиеся мощности позволяют Kyron буксировать прицеп, вес которого не превышает 2300 кг.

Несмотря на внушительные габариты: длину – 4660, ширину – 1880 и высоту – 1740 мм внедорожник отличается правильностью и гармоничностью пропорций. Ширина салона, на уровне плеч составляющая 1506 мм, гарантирует комфортное размещение пассажиров и удобство путешествия на значительные расстояния.

Вместительное багажное отделение с объемом 625 л позволяет осуществлять перевозку довольно габаритных грузов. Кроме того, часть их можно перемещать на крыше, где специально для этого установлены рейлинги, доступные в большинстве комплектаций.

Топливный бак имеет вместимость до 75 л, что гарантирует возможность длительного путешествия без частых остановок для дозаправки. Средний расход топлива, заявленный производителем, составляет 9,9-14,9 л/100 км в городе и 6,3-8,7 л/100 км за его пределами. До максимальной скорости 170 км/ч внедорожник способен разогнаться за 14,8 с.

В зависимости от комплектации Ssang Yong Kyron могут быть оснащены:

  • ESP – системой курсовой устойчивости;
  • BAS – системой помощи во время экстренного торможения;
  • ARP – защитой от опрокидывания;
  • HDC – системой контроля спуска со склона;
  • передними и боковыми подушками безопасности;
  • системой блокировки дверных замков;
  • системой оповещения о препятствиях сзади.

Заявленный расход топлива для дизельного двигателя составляет 8 л, для бензинового —  12 л на 100 км пробега. Максимально развиваемая скорость соответственно равна 166 и 170 км/ч. Благодаря широкой низкопрофильной резине СанЕнг Кайрона обеспечивается отличное сцепление колеса с грунтом.

Технико-эксплуатационные характеристики корейского кроссовера только подтверждают его универсальность, великолепную управляемость, непревзойденную мощность и безупречную функциональность. Благодаря гарантированной комфортности, экономичности, динамичности и удобству SsangYong Kyron является отличным решением для людей, не мыслящих свою жизнь без автомобиля.

Кайрон технические характеристики, SsangYong Kyron технические характеристики, СанЕнг Кайрон технические характеристики.


Цены указаны за автомобиль соответствующей комплектации белого цвета. Представленные на сайте данные о комплектациях, технических характеристиках, цветовой гамме, стоимости автомобилей SsangYong и их сервисного обслуживания носят общий информационный характер и не являются публичной офертой, определяемой положениями Статьи 437 (2) Гражданского кодекса Российской Федерации. Самую последнюю и подробную информацию вы можете получить у наших менеджеров.

ssangyong-rs.ru

Размеры и масса СсангЙонг Кайрон: описание, показатели

Размеры кузова — один из важнейших параметров при выборе машины. Чем больше машина, тем сложнее она в управлении в современном городе, однако и безопасней.

Технические показатели

Габаритные размеры СсангЙонг Кайрон определяются по трём величинам: длина кузова, ширина кузова и высота кузова. Как правило длину измеряют от наиболее выдающегося вперёд места переднего бампера до самого удалённого места заднего бампера. Ширину кузова мерят в самом широком месте: как правило это либо колёсные арки, либо центральные стойки кузова. А вот с высотой не всё так просто: её мерят от земли до крыши автомобиля; высота рейлингов в общую высоту кузова не входит.

Габаритные размеры SsangYong Kyron от 4660×1880×1740 до 4660×1880×1755 мм, а масса от 1845 до 2010 кг.

Россия

Размеры SsangYong Kyron рестайлинг 2007, suv, 1 поколение

Комплектации

Габариты

Масса, кг

2.0 Xdi MT 2WD Welcome

4660×1880×1740

1845

2.0 Xdi MT 2WD Original

4660×1880×1740

1845

2.3 MT 2WD Welcome

4660×1880×1740

1872

2.0 Xdi MT 4WD Original

4660×1880×1740

1953

2.0 Xdi AT 4WD Original

4660×1880×1740

1980

2. 3 MT 4WD Original

4660×1880×1740

1987

2.3 AT 4WD Original

4660×1880×1740

2010

2.0 Xdi MT 2WD Comfort

4660×1880×1755

1845

2.3 MT 2WD Comfort

4660×1880×1755

1872

2.0 Xdi MT 4WD Comfort

4660×1880×1755

1953

2.0 Xdi AT 4WD Luxury

4660×1880×1755

1980

2.0 Xdi AT 4WD Elegance

4660×1880×1755

1980

2.0 Xdi AT 4WD Comfort+

4660×1880×1755

1980

2.0 Xdi AT 4WD Comfort

4660×1880×1755

1980

2.3 MT 4WD Comfort

4660×1880×1755

1987

2. 3 AT 4WD Luxury

4660×1880×1755

2010

2.3 AT 4WD Comfort+

4660×1880×1755

2010

2.3 AT 4WD Elegance

4660×1880×1755

2010

2.3 AT 4WD Comfort

4660×1880×1755

2010

2.3 AT 2WD Comfort

4660×1880×1755

2010

Размеры SsangYong Kyron 2006, suv, 1 поколение

2.0 Xdi MT 2WD Welcome

4660×1880×1740

1845

2.0 Xdi MT 2WD Original

4660×1880×1740

1845

2.0 Xdi AT 2WD Original

4660×1880×1740

1920

2.0 Xdi MT 4WD Original

4660×1880×1740

1929

2. 0 Xdi AT 4WD Original

4660×1880×1740

1956

2.0 Xdi MT 2WD Comfort

4660×1880×1755

1845

2.0 Xdi AT 2WD Comfort

4660×1880×1755

1920

2.0 Xdi MT 4WD Comfort

4660×1880×1755

1929

2.0 Xdi AT 4WD Comfort

4660×1880×1755

1956

2.0 Xdi AT 4WD Elegance

4660×1880×1755

1956

2.0 Xdi AT 4WD Luxury

4660×1880×1755

1956

Европа

Размеры SsangYong Kyron рестайлинг 2007, suv, 1 поколение

Комплектации

Габариты

Масса, кг

2.0 Xdi MT 2WD

4660×1880×1740

1845

2. 0 Xdi AT 2WD

4660×1880×1740

1920

2.0 Xdi MT 4WD

4660×1880×1740

1929

2.0 Xdi AT 4WD

4660×1880×1740

1956

2.7 SPR AT 4WD

4660×1880×1740

1956

Размеры SsangYong Kyron 2005, suv, 1 поколение

2.0 Xdi MT 2WD

4660×1880×1740

1845

2.0 Xdi AT 2WD

4660×1880×1740

1920

2.0 Xdi MT 4WD

4660×1880×1740

1929

2.0 Xdi AT 4WD

4660×1880×1740

1956

koreanautoreview.com

Возможности полезного объема салона кайрона. — SsangYong Kyron, 2.3 л., 2011 года на DRIVE2

Полный размер

Небольшое продолжение рубрики «впихуемость кайрона» ))
Может кому пригодится мой накопленный барахольный опыт лайфхаков дачно-строительных перевозок…

Итак, проверено на себе, при условии что не нужны все посадочные места, а можно обойтись всего двумя, в кайрон, при правильно подобранной конфигурации правого переднего кресла, и сложенного правого заднего — прекрасно входит при закрытом багажнике небольшое количество досок, или похожих предметов длиной вплоть до 3,10 метра !
(На фото)
И при этом остается еще безопасный запас в 8-10 см до заднего стекла, благодаря его выпуклой аквариумной форме…и я настоятельно рекомендую его не превышать, дабы не рисковать что на ямке или кочке подпрыгнувший предмет кокнет заднее стекло!
(Эта особенность формы заднего стекла вообще меня часто выручала при перевозках длинномеров.часто возил так например, пластиковые декоративные 3м панели)

Можно и 3,15-3,20 м, но тогда не остается безопасного запаса до стекла.

Также могу сказать, что неоднократно легко возил в кайроне двери длиной до 2,3м и шириной до 1,1м, в том числе упакованные и балконные, в сборе с коробкой, просто сложив переднее и заднее правое сидение, положив и оперев их под нужным углом, по диагонали, к левому переднему водительскому сидению и заднему левому, при этом не загораживается необходимый обзор в правое зеркало, если все сделать правильно, то край предмета не выше правого плеча водителя.

Также повторюсь, возил в кайроне, сложив только задние сидения, под углом, уперев в потолок над головой водителя, и пачку из 33-34 штук дорожных «карт» из мет. проволоки, на забор, длиной 2м и шириной 1м.
(На фото)

Кстати, все то же самое, кроме 3м досок, применимо и к Тагеру, в нем я также перевозил вышеуказанные длиной 2,2-2,3м предметы — двери, разобранные садовые качели в здоровенной коробке и тп.

Так что, при необходимых навыках перевозок, кайрон — мой отличный помощник при строительстве и других делах, и позволяет мне обходится без прицепа и багажника.))
Всем ровных дорог и удачных перевозок.)

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

Полный размер

www.drive2.ru

SsangYong Kyron габариты, размеры кузова

SsangYong Kyron – автомобиль сегмента SUV, являющийся конкурентом для Mitsubishi Pajero Sport, Great Wall Hover и других внедорожников среднего класса. В автомобиле используется рамная конструкция и платформа от первого поколения SsangYong Actyon. Выпуск Kyron осуществлялся в период 2005-2015 г. Производство для российского рынка организовано на предприятии «Соллерс-Дальний Восток». Примечательно, что для этого завода Kyron стал первой моделью. Предприятие открылось в декабре 2009 года, а выпуск «Кайрона» продолжался до 2015 года. После этого внедорожник больше нигде не собирали.

Продажи начались в 2005-м, а в 2007-м состоялся рестайлинг. В результате модернизации передняя и задняя часть кроссовера претерпела небольшие изменения. Обновилась решетка радиатора и световая оптика, а также бампера. Кроме того, в интерьере появились новые варианты цветового оформления, доступные под заказ.

Размеры SsangYong Kyron

SsangYong Kyron SUV
Год выпуска Длина (мм) Ширина (мм) Высота (мм) Масса (кг)
2006, 2007, 2008, 2009 4660 1880 1740 1929

SsangYong Kyron предлагался с бензиновым мотором 2,3 литра, мощностью 150 лошадиных сил. Кроме того, еще была комплектация с 2-литровым турбодизелем мощностью 140 л. с. Кроме того, для корейского рынка предлагалась дизельная версия объемом 2,7 литра. Коробки передач – механическая пятиступенчатая, а также пяти- и шестиступенчатый «автомат».

Силовой агрегат у SsangYong Kyron имеет переднее продольное расположение, а система полного привода реализована по схеме Part Time. Межосевой дифференциал отсутствует, однако передний мост оборудован простым свободным симметричным дифференциалом, тогда как задний дифференциал – не блокирующийся. При этом есть возможность заказать версию с автоматической блокировкой, благодаря которой одно заднее колесо может заблокироваться – например, при проскальзывании. Это существенно повысило внедорожные способности автомобиля. В связи с отсутствием межосевого дифференциала работа полного привода не допускается на сухом асфальте. Кроме того, при активированной пониженной передаче скорость «Кайрона» не превышает 60 км/час.

avto-razmer.com

Ода багажнику Кайрона — SsangYong Kyron, 2.0 л., 2014 года на DRIVE2

Как я и обещал vuvazik, после ее фразы — раз нужно много места, то нафиг Дастеры, которые отчаянно рекламирует alexeymochalov, надо брать всем Кайроны — я пишу оду этой замечательной вместимости. Заранее скажу — я тоже люблю этот прекрасный багажник. А то ведь не поверите.

Багажное отделение Кайрона велико. Можно даже сказать оно монструозно. Виданное дело, 625 литров!
Для сравнения, у хэтчбэка форд-фокус объем всего 385 литров, почти в два раза меньше!
Если переводить в полезные литры и брать по поллитра на человека в день и 5 человек в машине, это дополнительно 96 дней постоянно угандошенного состояния, а за 96 дней между прочим можно объехать весь земной шар! У Жуль Верна вообще за 80 объехали, а у них не было ни Фокуса ни Кайрона, ни, между прочим и водки! Максимум какой-нибудь бренди.

Если Фокус решит показать фокус и откинет свои задние сиденья, то получится объем 1144 литра, и экипаж фокуса уже ликует и потирает красные от алкоголя носы, даром что трое теперь едут на крыше. Но Кайрон наносит ответный удар, и сидящие на крыше «трое лишних» торжественно поздравляют друг друга с 1570 литрами.

В общем, несомненно, по литражу огненных напитков Кайрон уверенно идет впереди. Правда у Патриота литраж 704 литра (но там понятно, нужно где-то хранить литры ГСМ взамен сочащихся из всех щелей), зато у Паджеро спорт всего 592 литра, что конечно не серьезно.

Линейные размеры багажника Кайрона тоже прекрасны.

сперто с просторов инета

На секундочку, с разложенными задними сиденьями длина до передних сидушек составляет целых 177,7 см
Т.е. я там даже помещусь, если согну немного ноги и прижму голову к груди. Могло бы быть и хуже!
Зато Оленебои vuvazik поместятся прямо без разборки, причем возможно прямо с ней в положении «стрельба лежа». Открыв багажник, внезапно, легко будет отстреливаться, причем возможно прямо на ходу.

Ширина же колеблется от метра до метра с кепкой, что позволяет погрузить в Кайрон немалое количество канистр, ящиков и других предметов.

Особого внимания заслуживает волшебный контрабандный ящик для провоза чего-нибудь запрещенного. Изначально предполагался он для инструментов, но жизнь показывает, что к тому моменту когда разберешь полностью загруженный багажник и доберешься до секретного ящика, поломка либо отремонтируется сама собой, либо сил ее ремонтировать уже не будет.

Полный размер

после аварии проще всего достать аварийный знак отсюда.

Возвращаясь к теме сна в Кайроне, нельзя не отметить что стык багажник- сложенные сиденья почти ровный. Ну он достаточно ровный для того, чтобы спина только заболела, но не отвалились, по крайней мере сразу. Но так как все владельцы Кайрона — мужики с гаечными ключами на 32, легко и непринужденно в багажник запиливается багажная система, типа фальшпол. Спать становится очень здорово, правда теперь докопаться до секретного ящика становится еще сложнее и его вполне можно использовать для транзита запрещенных вещей через границы. Погранец плюнет пытаться до него докопаться.

сперто с просторов инета

Естественно багажная система немного сокращает высоту багажника, зато в нем все становится на своем месте. Ну, чтобы добраться до этого «своего места» естественно придется разгружать половину или весь багажник. Особенно Кайроноводы любят это делать в грязи или под проливным дождем :)))

Естественно, такие объемы были недоступны без определенных жертв. Поэтому запасное колесо висит сзади снизу. Хотя я оговорился, почему колесо… ДОКАТКА!
Не, вы не ослышались, машине вседорожнику, чья стихия грязь и буераки, через которые он продирается на большой грязевой резине сзади повесили докатку. Некоторые от такой несправедливости ругаются и размещают полноразмерную запаску… в багажнике. Но багажник большой, он вынесет!
В него в принципе помещается 33 колесо! Честно.

Полный размер

а это уже мое фото

И после этого в него еще можно уложить много разных ништяков. Но уже не очень больших. Или не очень много.

Багажника Кайрона так велик и могуч, что туда даже переносят аккумуляторы (привет superhybrid). Правда их переносят потому что морда рвется, но зато сзади места достаточно.
Отдельные индивидуумы типа garmin-nn ставят в багажник даже дополнительный аккумулятор и Планар, правда при этом боковые ниши уже не годны особо для ценного груза.

Да что уж там, багажник Кайрона так объемен, что туда даже сдвигают задний ряд! Правда делают это не от хорошей жизни — задним пассажирам мало места распивать литры из первой части пьесы, но такая возможность есть и это — прекрасно!

Правда если все это совместить (фальшпол, аккумуляторы, планар, запасное полноразмерное колесо, сдвиг сидений) багажник немного подусохнет. Но не беда. Мы еще дружнее подожмем ноги и вообще надо меньше жрать!

Есть конечно небольшая подлость в том, что складывая задние сиденья и увеличивая объем багажника, мы теряем место под сиденьями. На деле это превращается в бесконечные перекладывания вещей по салону.

Товарищ Мамонт напрмиер, в пустой багажник Кайрона даже надувной матрас размещает!

Королевский лежак! Матрас полторашка

Ну и конечно не могу не поделится собственным опытом.
В относительно небольших поездках в Карон вмещается достаточно груза на семью с маленьким ребенком

Полный размер

Поместилось все, и даже места чуток есть. Ну как все… только минимум

А в дальних поездках, можно даже спать в машине!

Полный размер

Королевское ложе

Правда получается откинуть только широкую часть, и этот процесс каждый раз превращается в 15минутный квест «коза, волк и капуста» — когда надо все перетасовать по машине, при этом не опуская на грязную землю, и не мешая женской половине экипажа сидеть на водительском сиденье. В итоге спать сзади только женская половина экипажа и помещается, а папа спит сидя на водительском сиденье (а вы когда-нибудь спали несколько дней подряд сидя?). Всё остальные сидушки завалены перетасованным из багажника (и из под задней сидушки) скарбом и детским креслом.

Полный размер

Ну как королевское, в ногах продолжают спать канистры и прочий шмурдяк. Им тоже не хочется на улицу.

Но несмотря на это багажник Кайрона действительно велик. Вполне достаточен. Для, как сказал мой друг garmin-nn — барсетки.

Потому что я просто оставлю здесь это.

Полный размер

Полноразмерный матрас двушка. В машине в два раза больше багажа чем было в кайроне на последнем фото и водительское кресло тоже свободно. Ах да. Багажник тоже не переполнен. И тоже стоит планар и запасной аккумулятор. Два. И колесо запаска полноразмер. И бензопила

Всем добра, ставим мне лайки и овчарки. не бьем больно ногами и не пьем за рулем!

www.drive2.ru

Габариты Kyron II « www.mySsangYong.ru

Габариты Kyron II

Габариты автомобилей Kyron 2.3 M/T, Kyron 2.3 A/T

Kyron
2.3
M/T
Kyron
2.3
A/T
Длина (мм) 4 660
Высота (мм) 1 755
Ширина (мм) 1 880
Колея Передних колес (мм) 1 570
Задних колес (мм) 1 570
Свес Передний (мм) 885
Задний (мм) 1 035
Колесная база (мм) 2 740
Угол въезда (градусы) 26
Угол съезда (градусы) 23
Минимальный дорожный просвет Передняя ось(мм) 210
Задняя ось(мм) 199
Полная масса (кг) 2 530
Снаряженная масса (кг) 1 862 — 1 971 1 885 — 1 994

Запись создана: Суббота, 26 Декабрь 2009 в 22:49 и находится в рубриках Основные характеристики. Вы можете пролистать запись до конца и оставить отзыв. Уведомления в настоящее время не разрешены.

www.myssangyong.ru

Габариты Kyron

Добро пожаловать в SsangYong club!

03 | 04 | 2020

= =

 

Kyron
2.0Xdi
M/T
Kyron
2.0Xdi
A/T
Длина (мм) 4 660
Высота (мм) 1 740 (1 755 : с рейлингами на крыше)
Ширина (мм) 1 880
Колея Передних колес (мм) 1 570
Задних колес (мм) 1 570
Свес Передний (мм) 885
Задний (мм) 1 035
Колесная база (мм) 2 740
Угол въезда (градусы) 26
Угол съезда (градусы) 23
Минимальный дорожный просвет Передняя ось(мм) 210
Задняя ось(мм) 199
Полная масса (кг) 2 530
Снаряженная масса (кг) 1 929 — 2 001 1 956 — 2 028

 

====

*******************************************

Все статьи,фотографии указанные на сайте,были взяты с открытых источников интернета и технических руководств к машинам марки SsangYong

www.ssangyong-club.org

2006 SsangYong Kyron 2.0Xdi (141 лс) 4WD


Технические характеристики SsangYong Kyron 2.0Xdi (141 лс) 4WD 2006, 2007

Базовая информация
Марка SsangYong
Модель Kyron
Поколения Kyron
Модификация (двигатель) 2.0Xdi (141 лс) 4WD
Начало выпуска 2006 г
Оконч. выпуска 2007 г
Архитектура силового агрегата Двигатель внутреннего сгорания
Тип кузова Внедорожник
Количество мест 5
Количество дверей 5
Эксплуатационные характеристики
Расход топлива в городе 9.9 л/100 км
23.76 US mpg
28.53 UK mpg
Расход топлива на шоссе 6.3 л/100 км
37.34 US mpg
44.84 UK mpg
Расход топлива Смешанный цикл 7.7 л/100 км
30.55 US mpg
36.69 UK mpg
Топливо Дизельное топливо
Время разгона 0 — 100 км/ч 14.2 сек
Время разгона 0 — 62 mph 14.2 сек
Время разгона 0 — 60 mph (Рассчитано Auto-Data.net) 13.5 сек
Максимальная скорость 167 км/ч
103.77 mph
Соотношение мощность/вес 13.7 кг/лс, 73.1 лс/тонна
Двигатель
Мощность 141 лс @ 4000 об./мин.
Мощность на литр рабочего объема 70.6 лс/л
Крутящий момент 310 Нм
228.64 lb.-ft.
Расположение двигателя переднее, продольное
Объем двигателя 1998 см3121.93 cu. in.
Количество цилиндров 4
Расположение цилиндров Рядный
Диаметр цилиндра 86.2 мм
3.39 in.
Ход поршня 85.6 мм
3.37 in.
Степень сжатия 18
Количество клапанов на цилиндр 4
Система питания Дизель Н.В
Тип наддува Турбонаддув
Объем и вес
Снаряженная масса автомобиля 1929 кг
4252.72 lbs.
Допустимая полная масса 2530 кг
5577.7 lbs.
Максимальная грузоподъемность 601 кг
1324.98 lbs.
Объем топливного бака 75 л
19.81 US gal | 16.5 UK gal
Габариты
Длина 4660 мм
183.46 in.
Ширина 1880 мм
74.02 in.
Высота 1755 мм
69.09 in.
Колесная база 2740 мм
107.87 in.
Колея передняя 1570 мм
61.81 in.
Колея задняя 1570 мм
61.81 in.
Трансмиссия, тормоза и подвеска
Привод Полный привод
Количество передач (Механическая коробка передач) 5
Тип передней подвески Двойной поперечный рычаг
Тип задней подвески Винтовая пружина
Передние тормоза Дисковые вентилируемые
Задние тормоза Дисковые
Тип рулевого управления Рулевая (шестерня) рейка

Габариты Kyron

Добро пожаловать в SsangYong club!

28 | 04 | 2021

















=



=


































 
















Kyron
2.0Xdi
M/T
Kyron
2.0Xdi
A/T
Длина (мм) 4 660
Высота (мм) 1 740 (1 755 : с рейлингами на крыше)
Ширина (мм) 1 880
Колея Передних колес (мм) 1 570
Задних колес (мм) 1 570
Свес Передний (мм) 885
Задний (мм) 1 035
Колесная база (мм) 2 740
Угол въезда (градусы) 26
Угол съезда (градусы) 23
Минимальный дорожный просвет Передняя ось(мм) 210
Задняя ось(мм) 199
Полная масса (кг) 2 530
Снаряженная масса (кг) 1 929 — 2 001 1 956 — 2 028

 




====


























*******************************************

Все статьи,фотографии указанные на сайте,были взяты с открытых источников интернета и технических руководств к машинам марки SsangYong

Page not found — автомануал заказ автокниг с доставкой в любую точку мира

НАШИ ПАРТНЕРЫ:

Любой современный легковой или грузовой автомобиль можно обслуживать и
ремонтировать самостоятельно, в обычном гараже. Все что для этого потребуется – набор инструмента и заводское руководство по ремонту с подробным (пошаговым) описанием выполнения операций. Такое
руководство должно содержать типы применяемых эксплуатационных жидкостей, масел и смазок, а самое главное – моменты затяжки всех резьбовых соединений деталей узлов и агрегатов автомобиля.
Итальянские автомобили – Fiat (Фиат) Alfa Romeo (Альфа Ромео) Lancia (Лянча) Ferrari (Феррари) Mazerati (Мазерати) имеют свои конструктивные особенности. Также в особую группу можно выделить все французские машины – Peugout (Пежо), Renault (Рено) и Citroen (Ситроен). Немецкие машины сложные.
Особенно это относится к Mercedes Benz (Мерседес Бенц), BMW (БМВ), Audi (Ауди) и Porsche (Порш), в чуть меньшей — к
Volkswagen (Фольксваген)
и Opel (Опель). Следующую
большую группу, обособленную по конструктивным признакам составляют американские производители- Chrysler, Jeep, Plymouth, Dodge, Eagle, Chevrolet, GMC, Cadillac, Pontiac, Oldsmobile, Ford, Mercury, Lincoln. Из Корейских фирм следует отметить Hyundai/Kia, GM-DAT
(Daewoo), SsangYong.

Совсем недавно японские машины отличались относительно низкой первоначальной стоимостью и доступными ценами на запасные части, но в последнее время они догнали по этим показателям престижные
европейские марки. Причем это относится практически в одинаковой степени ко всем маркам автомобилей из страны восходящего солнца – Toyota (Тойота),
Mitsubishi (Мицубиси), Subaru (Субару), Isuzu (Исудзу),
Honda (Хонда), Mazda (Мазда или как говорили раньше Мацуда), Suzuki (Сузуки), Daihatsu (Дайхатсу), Nissan (Ниссан). Ну, а машины, выпущенные под
японо-американскими брендами Lexus (Лексус), Scion (Сцион), Infinity (Инфинити), Acura (Акура) с самого начала были недешевыми.

 

Отечественные автомобили также сильно изменились с введением норм евро-3. лада калина, лада приора и даже лада нива 4х4 теперь
значительно сложнее в обслуживании и ремонте.

что делать если машина не заводится, как зарядить аккумулятор, как завести машину в мороз. ответы на эти вопросы можно найти на страницах сайта и книг.
представленных здесь же

Автомануал — от англ. manual — руководство. Пособие по ремонту автомобиля или мотоцикла. различают заводские руководства и книги , выпущенные специализированными автомобильными издательствами.

Cайт Автомануал не несет никакой ответственности за возможные повреждения техники или несчастные случаи, связанные с использованием размещенной информации.

Размеры и масса СсангЙонг Кайрон: описание, показатели

Размеры кузова — один из важнейших параметров при выборе машины. Чем больше машина, тем сложнее она в управлении в современном городе, однако и безопасней.

Технические показатели

Габаритные размеры СсангЙонг Кайрон определяются по трём величинам: длина кузова, ширина кузова и высота кузова. Как правило длину измеряют от наиболее выдающегося вперёд места переднего бампера до самого удалённого места заднего бампера. Ширину кузова мерят в самом широком месте: как правило это либо колёсные арки, либо центральные стойки кузова. А вот с высотой не всё так просто: её мерят от земли до крыши автомобиля; высота рейлингов в общую высоту кузова не входит.

Габаритные размеры SsangYong Kyron от 4660×1880×1740 до 4660×1880×1755 мм, а масса от 1845 до 2010 кг.

Россия

Размеры SsangYong Kyron рестайлинг 2007, suv, 1 поколение

Комплектации

Габариты

Масса, кг

2.0 Xdi MT 2WD Welcome

4660×1880×1740

1845

2.0 Xdi MT 2WD Original

4660×1880×1740

1845

2.3 MT 2WD Welcome

4660×1880×1740

1872

2.0 Xdi MT 4WD Original

4660×1880×1740

1953

2.0 Xdi AT 4WD Original

4660×1880×1740

1980

2.3 MT 4WD Original

4660×1880×1740

1987

2.3 AT 4WD Original

4660×1880×1740

2010

2.0 Xdi MT 2WD Comfort

4660×1880×1755

1845

2.3 MT 2WD Comfort

4660×1880×1755

1872

2.0 Xdi MT 4WD Comfort

4660×1880×1755

1953

2.0 Xdi AT 4WD Luxury

4660×1880×1755

1980

2.0 Xdi AT 4WD Elegance

4660×1880×1755

1980

2.0 Xdi AT 4WD Comfort+

4660×1880×1755

1980

2.0 Xdi AT 4WD Comfort

4660×1880×1755

1980

2.3 MT 4WD Comfort

4660×1880×1755

1987

2.3 AT 4WD Luxury

4660×1880×1755

2010

2.3 AT 4WD Comfort+

4660×1880×1755

2010

2.3 AT 4WD Elegance

4660×1880×1755

2010

2.3 AT 4WD Comfort

4660×1880×1755

2010

2.3 AT 2WD Comfort

4660×1880×1755

2010

Размеры SsangYong Kyron 2006, suv, 1 поколение

2.0 Xdi MT 2WD Welcome

4660×1880×1740

1845

2.0 Xdi MT 2WD Original

4660×1880×1740

1845

2.0 Xdi AT 2WD Original

4660×1880×1740

1920

2.0 Xdi MT 4WD Original

4660×1880×1740

1929

2.0 Xdi AT 4WD Original

4660×1880×1740

1956

2.0 Xdi MT 2WD Comfort

4660×1880×1755

1845

2.0 Xdi AT 2WD Comfort

4660×1880×1755

1920

2.0 Xdi MT 4WD Comfort

4660×1880×1755

1929

2.0 Xdi AT 4WD Comfort

4660×1880×1755

1956

2.0 Xdi AT 4WD Elegance

4660×1880×1755

1956

2.0 Xdi AT 4WD Luxury

4660×1880×1755

1956

Европа

Размеры SsangYong Kyron рестайлинг 2007, suv, 1 поколение

Комплектации

Габариты

Масса, кг

2.0 Xdi MT 2WD

4660×1880×1740

1845

2.0 Xdi AT 2WD

4660×1880×1740

1920

2.0 Xdi MT 4WD

4660×1880×1740

1929

2.0 Xdi AT 4WD

4660×1880×1740

1956

2.7 SPR AT 4WD

4660×1880×1740

1956

Размеры SsangYong Kyron 2005, suv, 1 поколение

2.0 Xdi MT 2WD

4660×1880×1740

1845

2.0 Xdi AT 2WD

4660×1880×1740

1920

2.0 Xdi MT 4WD

4660×1880×1740

1929

2.0 Xdi AT 4WD

4660×1880×1740

1956

описание, характеристики, отзывы. Ssangyong kyron

Корейский автопром всегда ассоциировался с недорогими компактными автомобилями. Однако и в этой стране производят неплохие кроссоверы. Итак, один из них — Ssangyong Kyron. Это среднеразмерный рамный внедорожник, серийно выпускавшийся в период с 2005 по 2015 год. Помимо Кореи, эти автомобили собирают в России, Украине, а также в Казахстане. Что такое дизель Sanyeng Kyron? Обзоры, характеристики и характеристики автомобиля — далее в нашей статье.

Дизайн

Внешний вид автомобиля отличается от японских и европейских внедорожников. Так, в передней части автомобиль получил овальную решетку радиатора и рельефный бампер с круглыми противотуманными фарами по бокам. Капюшон с точностью повторяет линии головной оптики. Боковые зеркала заднего вида окрашены в цвет кузова и в некоторых комплектациях оснащены поворотниками. На крыше — обычные рейлинги.

Что владельцы говорят о качестве металла и лакокрасочного покрытия? По отзывам, Ssangyong Kyron хорошо защищен от коррозии.Сколы ЛКП — большая редкость для корейского внедорожника. Но даже при глубоких повреждениях на голом металле не образуется ржавчина.

Размеры, клиренс

Автомобиль относится к классу SUV и имеет следующие габариты. Длина корпуса составляет 4,66 метра, ширина — 1,88, высота — 1,75 метра. Колесная база составляет 2740 миллиметров. Дорожный просвет впечатляет — около двадцати сантиметров. Автомобиль отличается короткими свесами и не слишком длинной базой, поэтому отлично себя чувствует на бездорожье, — говорят отзывы.Но о проходимости этого внедорожника мы поговорим чуть позже, а пока перейдем к салону.

Салон автомобиля

Интерьер корейского внедорожника выглядит просто, но не вызывает отрицательных эмоций. Большой плюс — наличие свободного места. Достаточно как спереди, так и сзади. В нем действительно могут разместиться до пяти человек. Регулировка сиденья есть не только спереди. Задний диван тоже можно настроить под себя. Сами сиденья мягкие и удобные, говорят отзывы.

Центральная консоль немного наклонена в сторону водителя. В нем находится простая магнитола, блок управления климатом, пара дефлекторов обдува и стойка с дополнительными кнопками управления. Все элементы размещены необычно, но к этому можно привыкнуть. Руль — четырехспицевый, обтянутый кожей. Есть стандартный набор кнопок. Рулевое колесо имеет удобный захват и регулируется по углу наклона.

Также отзывы отмечают хороший уровень оснащения кроссовера. Итак, у дизельного Sanyeng-Kyron уже есть базовый климат-контроль, электрические стеклоподъемники и зеркала, хорошая акустика и подогрев передних сидений.

Багажник рассчитан на 625 литров поклажи. Под полом — ящики для инструментов. Также в багажнике есть защитная сетка и розетка на 12 вольт. Спинка сиденья складная. В результате получился грузовой отсек объемом более двух тысяч литров.

Технические характеристики

Для этого автомобиля предлагается два дизельных двигателя. Оба оснащены турбиной и имеют прямой впрыск топлива. Итак, базовый двигатель объемом два литра развивает 140 лошадиных сил.Дизель «Саньенг-Кайрон» на 2 литра развивает крутящий момент 310 Нм. В более дорогих комплектациях доступен 2,7-литровый мотор. Он развивает 165 сил. Крутящий момент — на 50 Нм больше, чем у предыдущего.

По отзывам, дизель Sanyeng Kyron достаточно экономичен. Так, на трассе автомобиль тратит на 165-сильный двигатель не более семи литров (оптимальный скоростной режим от 100 до 110 километров в час). В городе машина потребляет от 9 до 10 литров топлива.

О надежности двигателя

Оба двигателя производились по лицензии Mercedes-Benz.Вообще, неисправности в дизельном Sanyeng-Kyron возникают редко. Но есть детские болезни. Итак, стоит отметить механизм ГРМ. Sanyeng-Kyron (дизель) требует замены натяжителя цепи каждые 60 тысяч километров. Также сложно запустить дизельный двигатель в холодную погоду. Без дополнительного прогрева до -25 градусов невозможно запустить дизель Sanyeng Kyron. К тому же в машине слабый аккумулятор. С завода здесь установлена ​​батарея на 90 Ач. Обычные свечи накаливания могут заклинивать, из-за чего их приходится буквально вырывать из блока.

Что касается турбины, то ее ресурс составляет более 150 тысяч километров. Турбина надежна, но не любит долгих и продолжительных нагрузок.

Трансмиссия

Что касается трансмиссии, то для корейского внедорожника предусмотрена пятиступенчатая механическая или пятиступенчатая автоматическая коробка передач. Дизельный Sanyeng-Kyron может идти как с задним, так и с полным приводом через Part Time (без межосевого дифференциала).

Владельцы столкнулись с выходом из строя электронного блока управления автоматом и раздаточной коробкой.Стоимость вопроса 18 и 12 тысяч рублей соответственно. Также владельцы жалуются на дорогостоящую замену масла в АКПП. Со временем возникает дисбаланс карданного вала. Это может привести к заклиниванию внешнего подшипника. Передние ступицы тоже выходят из строя. Владельцам рекомендуется устанавливать более надежные от компании Musso. Мануал надежнее автомата, но тоже требует ухода. Масло в нем меняют не реже одного раза в 100 тысяч километров. Также нужно следить за состоянием пломб и вовремя их менять.

Ходовая часть

Автомобиль имеет независимую переднюю подвеску. Сзади — зависимая, рессорная. Тормозная система дисковая. На передних колесах установлены вентилируемые тормоза.

Test Drive

Как дизельный Sanyeng Kyron ведет себя на ходу? По отзывам, характеристики подвески не рассчитаны на наши дороги. При ударе о яму ощущается заметный толчок и стук подвески. Но надо сказать, что у дизеля неплохая динамика разгона. Автомобиль резво набирает скорость со светофора и плавно тормозит, без рывков.Управление неплохое, и разницы между задним и полным приводом нет (кроме проходимости). Равно рулится на любом драйве. Но чего не хватает в этой машине, так это заднего парктроника. Это даже не вариант. А заднее стекло очень маленькое, и припарковаться иногда приходится наугад.

За городом машина ведет себя уверенно. Он входит в повороты без кренов и легко разгоняется до максимальной скорости 167 километров в час.Однако оптимальная скорость — до 110. На более высоких скоростях за машиной нужно постоянно следить — ее немного сносят с дороги. Также на скорости есть шум от боковых зеркал и свист в нижней части.

Sanyeng Kyron Off-Road

По отзывам, на дороге этот автомобиль ведет себя отлично. Автомобиль уверенно преодолевает крутые песчаные склоны и холмы. По сравнению с конкурентами Sanyeng-Chiron показывает отличные результаты. Короткие свесы и большой клиренс позволяют машине добраться туда, где остальным будет сидеть «пузо».Кроме того, стандартная машина оснащена широкой 255-й резиной с 18-дюймовыми колесами. Отдельного внимания заслуживает полноприводная версия. Саньенг Кайрон действительно способен размять грязь и выбраться из любой ловушки.

Обращаем ваше внимание, что, согласно инструкции по эксплуатации, езда по сухому асфальту с подключенным передним приводом означает неисправность трансмиссии. Итак, раздаточная коробка выходит из строя. А стоимость его ремонта может доходить до 60 тысяч рублей. Поэтому полный привод следует использовать только в экстренных случаях.

Заключение

Итак, мы выяснили, что такое корейский внедорожник Sanyeng Kyron. В целом это хорошая универсальная машина. Эта машина не слишком большая, ее можно эксплуатировать по городу, а в выходные на ней можно спокойно выезжать всей семьей на природу. Дизель Sanyeng Kyron очень экономичен. Но если хотите меньше тратить на обслуживание, стоит брать версию с пятиступенчатой ​​механикой.

SsangYong Kyron (Сантенг Кайрон) ресурс и техническое обслуживание двигателя и коробки передач.Техническое наполнение и оборудование

Год выпуска: 2013
Расход топлива:

Достоинства: Цена , мощный экономичный двигатель, мягкая автоматическая коробка, полный привод, просторный салон, большой багажник, отличная шумоизоляция

Недостатки: несбалансированная подвеска, плохое поведение на высоких скоростях, неадекватный датчик дождя, ЦИФРА видимости

Отзыв:

Сегодня первый полноценный, пробег 10000км, до этого ехал 5000км.По рекомендации конечного дилера меняли масло и фильтр, например условия эксплуатации у нас сложные. Пробег конечно не бог новостей, но сопли уже прошли, лето и осень будут считаться позади, первые выводы постараюсь изложить.

Давно хотел внедорожник. Но все как-то не складывалось. Перед покупкой Кайрона Юзал Киа Рио это была первая машина купленная новой в салоне. Четыре года с Рио пролетели как одни, без эмоций, без поломок, обыкновенно, и мечта пересесть на внедорожник не отпускала.Год назад начал искать Рио замену внедорожнику. Обошла все автосалоны, опробовала, наверное, все, что имело высокий клиренс и полный привод. Я не хотел покупать подержанную машину. Но количество денежных знаков, которые я мог потратить на покупку новой машины, было жестко ограничено одним миллионом наших денег. Трудно было вложить эту сумму в такое количество, коробка автомат, двигатель не меньше двухместного, просторный салон, просторный багажник. Вот так выбор пал на Cayron.У меня нет предубеждений после предрассудков Рио, а Svangigyong специализируется на производстве внедорожников, и, думаю, не прошли годы сотрудничества с Mercedes. В наличии На момент обращения в салон в комплекте сьюта был только черный кайрон, с учетом скидки он стоил несколько дороже миллиона, но ждать не хотелось, посоветовались с жена и решила брать, теперь не жалею.

Теперь по порядку.

Внешний вид.

Мое мнение помешала бы мелкая подвеска.Но мне очень нравится моя жена. В одном сойдется машина не безликая.

Комфорт.

Интерьер простой и удобный, без восторга, но практичный. Пластик в основном жесткий, местами сильно царапается. Но есть мягкие вставки, делающие нотки комфортными. Сайты не говорят, что вал, но вполне хватит и спереди, и сзади. Есть где разложить мельчайших, сволочь действительно совсем крохотная. Комфортное водительское кресло с поясничной опорой, хорошей боковой поддержкой и эффективным обогревом.Регулировок кресла по комплектации должно хватить, а вот руль регулируется только по углу наклона. Сзади сиденье крепкое и не очень удобное, правда, путешествующие по галерее ребята не жалуются. Задний ряд легко складывается, образуя большое багажное отделение. Плиту, холодильник, байк в сборе можно скачать без проблем. Багажник кстати и в исходном состоянии немаленький. Мы часто выезжаем на природу с большим багажом, которого всегда достаточно.Неплохо решить вопрос из запасной комнаты, она снаружи под днищем и место лишнего не занимает, да и в багаже ​​кричать не надо. Штатная магнитола издает хороший звук, регулировки поставлены на руль. Шумоизоляция после Рио кажется просто идеальной. Даже рев дизеля слышен только в момент разгона. Климат-контроль летом работал отлично. Теперь в холодную дождливую погоду в автоматическом режиме задерживает боковые окна, надо, как в старые добрые времена, ручки крутить.Утром машину греют потихоньку, попогнары копят, не по детски. В моей комплектации обогрев заднего ряда вообще супер. Удивил меня алгоритм работы датчика дождя, дворники забивают как-то нефпле. Когда никакой святыни не видно, иначе они начинаются с почти чистого стекла. Так что я с этой системой и не дружил, отключился. Обзор впереди из-за широких стоек не очень, лупить надо по очереди. За стойками машины прячутся не те пешеходы.Назад Обзор Тоже плохие болеутоляющие.

В движении.

Подвеска вроде в целом не жесткая, я бы сказал упругая. И резина высокопрофильная на 16. Но неровности четко передаются на кузов. Задние пассажиры на гребне, на перекрестках просто прыгали. А на высоких скоростях 120-130км / ч клапан проявляется и в некоторых случаях машина немного едет по пути, нужно держать таран. Машинка Кеаой тоже не нравится. Так что баланс между жесткостью, устойчивостью на дороге и корейцами определенно не устойчив.Но дизель и автомат меня радуют. От низов тяга двухцветная машина разгоняется как пушка. На высоких скоростях динамика ослабевает, но остается достаточной для обгона. Коробка работает мягко и четко. Есть ручной режим с управлением на руле и на селекторе скоростей. Работает честно, но ненамного эффективнее в автоматическом режиме, в нормальных условиях. В сложных дорожных условиях при определенных навыках помогает. Расход солярки по городу 11,5-12л.Интерсити 7,5-8л. Чтобы не испытывать судьбу только на Лукойле. Сейчас активно прорабатываю тему зимней эксплуатации. Это не заливка геля, чтобы заливать гель, ставить ТЭН или нет, дизельки раньше не владели.

Проходимость.

Несмотря на то, что машина довольно высоко поднята, важные агрегаты Картер, коробка, дозатор уязвимы. Надо обязательно поставить стальную защиту, что я и сделал сразу. Мы сторонники активного отдыха и всей семьей любим путешествовать.И это не поездка в гражданский туризм или пикники в черте города, мы всегда ехали туда, где за транспортом. Вдали от цивилизации, ближе к природе. И надо сказать, даже в Рио удалось побывать в нетронутых уголках. Кайрон может быть и не годится без подготовки покатушек 4х4, для наших целей подойдет идеально. Мы уже оценили все преимущества большого клиренса и полного привода. Отличная тяга на днище в купе с приводом на четыре колеса позволяет уверенно двигаться практически по любой пересеченной местности.Без фанатизма, конечно, но там, где Спорт Спорт и Прочие Каши не дошли.

Посмотрим, как себя покажет Кайрон. Был ли у меня выбор? На данный момент да. Какой еще большой, рамный, полноприводный двухлитровый дизель с автоматической коробкой и кожаным салоном известного производителя можно купить за миллион с маленьким? Возможно, нет. Всем удачи на дорогах!

Достоинства: Большой Плюс: Сравнительно небольшой расход топлива, если не давить на штучку, то по трассе порядка 10-12 л / 100 км.В городе около 15 литров. Двигатель и трансмиссия «Мерседес Бенц» работают надежно, правда при переключении передач (у меня механик) летом в коробке слышен характерный щелчок-масло … Мотор заводится без проблем в самый сильный мороз. Оцинковка кузова, антикор и шумоизоляция выше всяких похвал, даже старых ротов Yongi еще не видел. Проходимость замечательная, зимой на метровых ковриках снега на дороге было незаметно, летом даже блок дифференциала не включал — грязи не было нужды идеально.Огромный багажник вмещает все необходимое. Управляемость отличная: круговой переключатель в одном пальце, срок стабильности супер. Емкий и качественный аккумулятор, так как при покупке авто пока менять не нужно, хотя зимой автозапуск использует …

Недостатки: минусовые моменты: Дороги в сервисе, запчасти сложно найти, по крайней мере В Самаре расходники продаются только в двух магазинах, не считая официального дилера. Второй раз подряд заклинило замок (или замок замка) багажника, так что открыть не могу, в ближайшее время поеду к дилеру — пусть разбираются.Автомобиль большой, поэтому динамика разгона с таким скромным мотором оставляет желать лучшего. Непонятный климат-контроль: включаешь зиму в авторстве — начинает дуть по ногам. Датчик дождя тоже замечательный: то дворники во вровес не работают, то со всей мощностью начинают ладить. Мотор очень меньше по топливу, немного по качеству бензина ниже, машина начинает безжалостно сливаться. Нашел такой выход: при каждой заправке добавляю в бак октан-корректор «HI Gear 105».Бензин-92, потому что 95-го, мол, у нас на даче нет, все работает как часы … При посадке на место водителя нужно привыкнуть к тому, что правое колено упирается в тоннель из торпед он подходит не всем. Средний свет слабый, хорошую картинку получить только включив противотуманки, на шниве они, например, не нужны. После покупки машины обнаружил полное отсутствие запасных предохранителей. Бардачек очень маленький. Пластиковые заглушки розеток прикуривателя, гнезда багажной решетки в потолке, крышки зеркал в солнечные визиты очень хрупкие, на раковине казахов с узбеками их мало… Очки ставлю в верхний одник, не могу достать.

Отзыв:
Машина хорошая. При разумной эксплуатации прослужит долго, останутся даже дети. Двигатель, трансмиссия, подвеска, рама кузова, большие катки — все высочайшего качества, а недостатки — мелочи, которые меня сильно не напрягают.

Система ADAPTIVE DYNAMICS Функция автоматического выбора высоты кабины Системы резки Система Noble TERRAIN RESPONSE® 2 Круиз-контроль на низких скоростях При движении по различным типам поверхности AII-terrain Progress Control Панорамная крыша (включая электрические жалюзи) Шумоизолирующее лобовое стекло, ламинированное — атермальные стекла ( только лобовое).Затонировал стекла в задних дверях, боковинах кузова и дверях багажного отделения. Стекла передних дверей с водоотталкивающим лобовым стеклом лобовое стекло — лобовое стекло с подогревом — с датчиком освещенности и датчиком дождя. Зеркала заднего вида — электропривод, автопоток, подогрев и память настроек. Лампа Range Rover Лампа Лампа Зеркало заднего вида — Автобампинг Передние противотуманные фары Адаптивные ксеноновые фары (AFS) (с омывателем) со светодиодной функцией УЦИ Автоматическое переключение дальнего света Фары 21-дюймовые световые указатели с 10 спицами — Diamond TURNED — Style 101 : запасное колесо Система регулировки давления воздуха в шинах предпусковой подогреватель с карманами дистанционного управления в спинках передних сидений с кожаной отделкой передних и задних подголовников с боковыми опорами встроенная надпись «Autoblography» на спинке среднего заднего сиденья Расширенный пакет внутренней отделки Обивка потолка Alston (только с двойным солнцезащитным козырьком) рулевое колесо с кожаной обивкой и двойными солнцезащитными козырьками с подогревом климат-контроль · 4-зонный индивидуальный пакет наружной подсветки салона для курильщиков (пепельница и прикуриватель спереди) передние и задние коврики с контрастной окантовкой Oh и металлом UL, Голк Ами.Алюминиевые накладки на пороги с подсветкой и надписью Autoblography Солнцезащитные шторки задних сидений с электроприводом Сигнализация с датчиком громкости (включая функцию Battery Back Up Sounder) Первая помощь Knight Датчики Парковочная камера заднего вида (в комплекте) Дверные доводчики Access в салон Preconney Управление салоном и таймер Дополнительный проигрыватель отходов бака Увеличенная громкость Сенсорное бесконтактное открытие двери багажника (движение ногой) Навигационная система со встроенным жестким диском Поддержка аудиосистемы Bluetooth® Meridian с объемным звуком мощностью 825 Вт LNControl ™ Пакет услуг Protect (Дополнительная помощь по Ecall, BCall, BCall Просмотр информации об автомобиле и дистанционное управление набором функций с помощью смартфона) Сенсорный монитор с технологией двойного изображения Dual View (вместе с 1 комплектом беспроводных наушников) развлекательная система для Задние пассажиры с сенсорным онитором м 10.2 «и дистанционное управление (вместе с 2-мя наборами беспроводных наушников и одним USB для второго ряда сидений) варианты производителя: складывающееся буксирное устройство« 028EJ »со складывающимся электроприводом (в комплекте с электрооборудованием и усилением)». 033TN «Задние представительские сиденья из полуанилиновой кожи, класс — стиль 26» 033U «RAIL.L Коричневая внутренняя палитра» 050AQ «Полноразмерное запасное колесо» 086GC «Система камеры кругового обзора (система камеры кругового обзора). (Включая камеру заднего вида OMR)» 086GF «Функции обнаружения обратного движения (функция распознавания движения по направлению к транспорту [инструменты), Монитор слепых зон (функция отслеживания других транспортных средств и предметов в« мертвых »зонах) и обнаружение закрытия транспортного средства (функция распознавания приближения к автомобилю с помощью автомобиль; зади другой автомобиль).»088hf» Отделка Shadow Walnut «135Un» Направляющие в багажник и фиксированные поперечины Электрические пороги Владелец автомобиля просит автосалон и звонок родавцов машины не беспокоить ему

➖ Динамика
➖ Дорогое обслуживание
➖ Жесткая подвеска

плюсы

➕ Вместительный багажник
➕ Комфортный салон
➕ Проходимость

Достоинства и недостатки Sahang Kairon 2008-2012 определены на основании отзывов реальных владельцев. Более подробные плюсы и минусы SsangYong Kyron 2.0 и 2.3 дизель и бензин с механикой, автоматом и полным приводом 4WD можно узнать из рассказов ниже:

Отзывы о собственности

В личном пользовании авто уже пятый год. Не знаю как в других городах, но в Казани нет нормального официального дилера Ssang Yong (некоторые развелись). Неквалифицированный технический персонал, который просто убивает машину …

Общее впечатление от авто положительное, сборка хорошая. К дизельному топливу (только ЛУКОЙЛ !!!) подходить нужно очень осторожно, а то можно уложиться на замену или ремонт форсунок, что сильно вредит карману.

Машина действительно очень удобная и огромная внутри, в багажник можно засунуть что угодно. Множество дополнительных электронных дисков. Отлично подходит для загородных поездок по полям и лесам. Расход в пределах 9 литров, что, на мой взгляд, неплохо для машины в 2,5 тонны.

Обслуживание дорогое. Официальные портят общее впечатление от марки своими руками (особо выделяется дилер дилера Ipsum-auto). Рулевые рейки не очень, текут начинают уже через 60-70 тыс км.Электрика слабенькая, постоянно горят лампочки (как внешние, так и в салоне). При простуде геморр, а в остальном все нормально.

Отзыв на SsangYong Kyron 2.0 Diesel (141 л.с.) с автоматом 2009 г.

Видеоотзыв

Первые впечатления совпали с заносами в городе и выпадением большого количества снега. Движение отличное! Машина большая, теплая, дети довольны, жене нравится. Огромная машина за небольшие деньги!

По управлению и поведению на дороге: подвеска жесткая, для размеренной езды руль на трассе с нуля управляется одной рукой без напряжения.

Хочу отметить хорошую шумоизоляцию. Открываешь окна и сразу слышишь двигатель и шины, закрываешь — как будто с улицы пошел домой! Все шумы исчезают! Теплоизоляция — на морозе и сильном ветру в машину можно ехать в рубашке, холодный воздух не сифонить, да и сама машина теплая.

Отзыв о SsangYong Kyron 2.3 (150 л.с.) на механике 2011 года

Внедорожные качества. Кайрон более чем радует, его повышенные внедорожные качества по сравнению с простым кроссовером для меня как некий бонус.По жесткой дороге езжу на заднем приводе. Где снег, лед, бесстрастная грязь — подключаю передние по мере надобности. Есть пониженная трансмиссия, контроль качения под уклоном, но я ими не пользовался.

По грязи едет хорошо, в этом потом убедился. Вытащил из грязи два безнадежных седана соседей по СНТ почти на холостом ходу без молитв. Немного проехал там, где боятся ездить на обычных машинах, без фанатизма, конечно, аккуратно. Машина меня очень порадовала, чувствую себя уверенно.Ставлю большой плюс.

Комфорт. Хотел не хуже Пассата Б6. Размер имеет значение. Автомобиль был немного шире пассата, но немного короче, а в целом — больше (транспортировались шкафы и диваны в разобранном виде).

Версия Elegance имеет кожаный салон (из дуббанита, но крепкая кожа), электрические настройки сидений и прочие атрибуты современного автомобиля (ну не совсем все, но вполне достаточно). Все это можно найти в описаниях.

Разное говорят о жесткости подвески.Перед покупкой устроил тест-драйв, прошелся по знакомым неровностям. Ощущения вполне нормальные по сравнению с Passown B6, мне показалось даже лучше. У Passat B6 были относительно жесткие подвески. Пишут, что сзади сидящим пассажирам в Кайроне неудобно из-за тряски из-за зависимой задней подвески. Думаю, что да, хотя мне никто не жаловался.

Шум от ходовой части при движении меньше, чем у Passat B6, Skoda Octavia и вообще у многих машин среднего класса.Двигатель шумит больше. Особенно напрягает шлам в диапазоне от 1500 до 2000 оборотов, говорят, что характерно для этого двигателя старого образца.

Двигатель. Собственно выбирать особо не пришлось. Есть дизель 141 л.с. с турбиной и бензин 150 л.с. Просто с впрыском. Оба они откровенно слабые для современной жизни с массой автомобилей в две тонны, впрочем, как и 15 лет назад. Выбрал бензин — он чуть-чуть мощнее, да и проблем меньше.Считаю, что единственный недостаток — это повышенный расход топлива. В остальном — солидные плюсы. Зимой в -20 я тихонько завожу машину и пока аккуратно подметаю снег, салон, стекла и сиденье у меня уже несколько жарко, а после первого светофора уже тепло.

Сергей, Отзыв о Sang Ag Cairon 2.3 (150 л.с.) АКПП 2011

В сравнении с алмерами, хотя сравнивать их некорректно. Плюсы:

— Посадка высокая, подвеска мягкая, кочки глотает на ура.Огромный багажник, никакой такой дешевизны, как в Альмерсе, где все были спасены. Удобный руль и педали.

— Стоимость содержания. Слабая динамика, так как есть ярко выраженный турбой на 1500 оборотов. Проверка Плохая видимость назад.

Хозяин едет на SsangYong Kyron 2.0D MCPP 2013г.

Машиной владею три года. Комплектация практически максимальная, т.е. кожаный салон, подогрев сидений и … и все! В Допе достался прогретый двигатель.

Если взвесить все и против, то машина больше похожа на то, что нет. Автомобиль не для гонок. Можно перенести неспешную поездку. В морозы завелась без проблем — прогрелся прогретый двигатель. На момент покупки это самый оптимальный вариант с дизелем и полным приводом, да еще и относительно бюджетный.

Посоветуете ли вы его при покупке? Рыбаку или охотнику с дачей, семьей и детьми — однозначно да. Из плюсов высокая посадка и комфорт водителя и пассажира (даже несмотря на спартанский интерьер и жесткую подвеску).Хороший вместительный багажник. Пассажиров за пассажирами тоже вполне хватает. Внешность на любителя, но лично меня устраивает. Контроль хороший.

LCP. Уже на втором курсе «Рыжик» оказался на стыке лобового стекла и кузова. Двигатель дорожный, но не очень. АКПП Можно приспособить, но иногда тупо. Задние рессоры не просил три года.

Отзыв о Sang Ag Cairon 2.0D (141 л.с.) на 2014 год



8

SsangYong Kyron, 2008

Машину взяли с мужем себе.Идеальная машина для поездки по городу и за город! Кирюша — каркас, обеспечивающий двойную безопасность! Салон тканевый, не брендовый, иногда катал кошку, в салон шерсть не липнет вообще! За счет высокой посадки и полного привода можно преодолевать трудности в непогоду.)))) За счет дизеля мало кушает! Очень большой и удобный багажник! Для нас это было огромным плюсом.) Это идеальный друг для любой семьи!



1

SsangYong Kyron, 2008 г.

Автомобиль хороший, один хозяин, сиденья с подогревом, 4 подушки безопасности, стеклоподъемники электрические, центральный замок, задние сиденья раскладываются, образуют кровать, очень вместительный, можно перевозить мебель и бытовую технику.Очень удобно для семьи, для отдыха. Устойчивый на трассе, хорошая проходимость. Плюсы: Хорошие дороги на бездорожье, устойчивость, семейный автомобиль. Минусы: не новинка.



7

SsangYong Kyron, 2007

Автомобиль прост в управлении. Очень хорошая управляемость и проходимость. На рыбалке постоянно езжу и нигде не выпрямляюсь, хотя резина уже изношена. Я не хочу говорить о снеге, он его не чувствует. Небольшой расход топлива при нормальной езде. Динамика разгона конечно не у Феррари, но на обгонах чувствуешь уверенно, турбина срабатывает и скорость довольно таки приличная.

SsangYong Kyron, 2010 г.

Уверенный, спокойный стиль езды. Высокая проходимость. Отсутствие каких-либо сбоев, кроме трех лампочек. Очень вместительный и функциональный интерьер позволяет максимально использовать внутреннее пространство. Клиренс позволяет преодолевать очень глубокий снег, при использовании нисходящей передачи вытянутый на глубину до пола колеса. Достоинства машины: надежная, вместительная. Расход по трассе около 11 литров. Недостатки: В пробках — хороший аппетит (около 14.5 литров на 100 км). Хотя с таким объемом вполне объяснимо. Да очень даже для тех, кто не ходит на покатушки, рыбалку, охоту — везде ездит.

туго прошивается? Плюсы и минусы

SsаngYong Kyron — южнокорейский кроссовер. Автомобиль выпускается с 2005 года. Изначально для российского рынка Chiron собирался в Набережных Челнах, а с декабря 2009 года — во Владивостоке (это была первая модель нового предприятия «Соллерс — Дальний Восток»).

Не случайно Kyron получил свои «внедорожные корни», ведь работа с внедорожниками, можно сказать, у SsangYong в крови. Еще во время войны между Северной и Южной Кореей появилась компания Donghwan Motor, которая занималась производством военных вездеходов. Спустя пару лет компания сменила название на SsangYong и продолжила заниматься автомобильной промышленностью, но на этот раз гражданской. Постепенно она начала скупать другие корейские компании, создав автомобильную монополию.Первым гражданским внедорожником концерна SsangYong стал Korando Family, имевший. Эта деталь была впоследствии принята Кайроном.

Частично предшественник Kyron, разработанный Кеном Гринли (который также разработал Kyron). Кроме того, впервые на Musso был установлен лицензионный двигатель Mercedes-Benz, который позже перекочевал на Kyron. Однако Musso — полноценный внедорожник, а Chiron создавался, прежде всего, как городской кроссовер. Платформа для него, которая выпускается с 2001 года (сам Rexton построен на базе Mercedes-Benz M-класса).

Через год после дебюта Кайрона в продажу поступил SsangYong Actyon. Эти две машины являются одноклассниками и отличаются только кузовом и дизайном интерьера. SsangYong Actyon выпускался с 2006 по 2011 год, но его производство было закрыто из-за повышенного спроса на Chiron. Однако Кайрону не суждено было остаться одному. В том же 2011 году на мощностях дальневосточного завода «Соллерс» возобновлено производство брата Кайрона по классу — обновленного SsangYong New Actyon.

Технические характеристики

Кузов автомобиля имеет рамную конструкцию, что дает множество преимуществ.Рама изготовлена ​​из высокопрочного металла, добавляет автомобилю веса, тем самым устраняя вибрации внутри кабины во время движения. Кроме того, в случае столкновения кузов серьезно защищен от деформации.

Еще одним плюсом внедорожных характеристик автомобиля является конструкция крыльев. Инженеры SsangYong сумели спроектировать их таким образом, чтобы даже при движении по грязи очки Kyron были надежно защищены и оставались чистыми.

На российском рынке 2.Для кроссовера предлагается 3-литровый бензиновый двигатель, а также 2,0-литровый турбодизель — особая гордость «корейца», доставшаяся в наследство от Mercedes. На других рынках дизельный Kyron также встречается в версии 2,7 литра.

Кен Гринли, дизайнер Chiron, признался, что при создании первой версии автомобиля он слишком увлекся культурой средневековья. В результате интерьер получил много округлости в конструкции приборов, а рукоять «ручника» в целом была похожа на рукоять меча.Столь нестандартная внешность Кайрон показалась маркетологам компании слишком провокационной, и ее «успокоили» рестайлингом.

Изначально Chiron собирался на заводе в Набережных Челнах, где тогда же производилась машина «Ока».

Ни в какой, даже самой богатой конфигурации Kyron нет штатной магнитолы. Его установка будет производиться дилером или владельцем самостоятельно.

Плюсы и минусы

Фактически ближайшим соперником корейского кроссовера можно считать Suzuki grand Vitara.При аналогичных габаритах Chiron может похвастаться более просторным салоном и возможностью регулировки руля по вылету (отсутствие этой регулировки на Grand Vitara — парадокс, которому нет объяснения).

Еще один плюс в копилку Кайрона — большой объем багажника, который можно увеличить, сложив задние сиденья (до 1085 литров).

Из минусов можно выделить отсутствие на Chiron режима помощи при спуске с горы, что характерно для любого современного внедорожника.

Наконец, совершенно неожиданный недостаток — стоимость обслуживания автомобиля в России. Несмотря на свое корейское происхождение, цены у официальных дилеров совсем не «корейские».

В целом SsangYong Kyron и Suzuki Grand Vitara — это автомобили разных технических характеристик. Chiron предлагает владельцу уверенную тягу на низких оборотах (в версии с дизельным двигателем), комфорт и надежность даже на бездорожье. В свою очередь, Vitara более шустрая машина, она трясет и чувствуется прохождение каждой неровности, что добавляет драйва во время загородной поездки.

Целевая аудитория

SsangYong Kyron
— выбор любителей комфортного передвижения по городу и регулярных пикников на природе. В меру мощный, надежный и вместительный, он отлично подойдет для небольшой семьи. Кроме того, не забывайте, что Kyron — флагман линейки SsangYong по очень разумной цене.

Награды и цифры

В 2006 году британский журнал 4×4 включил SsangYong Kyron в список лучших внедорожников года.Автомобиль занял 6-ю позицию с результатом 29 баллов (для сравнения, победитель Jeep Commander — 39).

В 2007 году Хирон был включен в список претендентов на титул «Автомобиль года» в Европе, но не дошел до финала, не говоря уже о победе.

25 марта 2010 года завод «Соллерс — Дальний Восток» торжественно отметил тысячный Кайрон, сошедший с конвейера. Всего в 2010 году в России было продано 1548 автомобилей SsangYong Kyron.

В России SsangYong Kyron приняли довольно тепло.На фоне конкурентов он выделялся весьма умеренной стоимостью. А сборка на заводах Sollers в Набережных Челнах (с конца 2006 г.) и Владивостоке (с 2010 г.) только укрепила его успех на рынке. Покупателей впечатлил мощный внедорожный потенциал «корейца». Полный привод реализован по системе Part Time, без межосевого дифференциала. В нормальных условиях движения крутящий момент приводит в движение задние колеса (режим 2H), а на бездорожье или скользких поверхностях передняя ось жестко подключается (режим 4H).Его можно использовать на скорости до 80 км / ч. На бездорожье выручают понижающая передача (режим 4L) и задний дифференциал повышенного трения.

Материалы отделки добротные, сборка аккуратная. Но дизайн интерьера подходит не всем.

Русские Кайроны щедро оснащены. В базовой версии Original полноприводный внедорожник (есть и заднеприводные версии) поставляется с ABS и EBD, кондиционером, двумя подушками безопасности, противотуманными фарами и подогревом передних сидений, электрическими стеклоподъемниками и зеркалами, а также легкосплавными дисками 16 дюймов. .Версия Comfort дополнена климат-контролем, аудиосистемой 2DIN с CD / MP3-плеером и рейлингами на крыше. Дорогие версии Comfort +, Elegance и Luxury оснащались системой стабилизации ESP и четырьмя подушками безопасности. А самые богатые версии Elegance и Luxury оснащены кожаным салоном и электрически регулируемыми передними сиденьями. В Luxury также есть люк и задний диван с подогревом.

Двигатель

Ходовая и кузов

В передней рессорной подвеске слабые как верхние, так и нижние шаровые опоры (по 1300 руб.), О чем порой не позаботились даже 10 тыс. Км.Армированные детали служат до 50 тыс. Км. Через два-три года, как правило, проседают задние рессоры (по 2200 руб.) — подойдут передние рессоры от Рекстон или задние от Шеви Нива. Были случаи поломки заднего моста (68 000 руб.) После 50 000 км. В рулевом наконечники недолговечные (по 1300 руб.). Сама рейка считается ремонтопригодной. Но неформалы могут подтянуть шайбы и заменить сальники за 3000 руб. — хватит на 20-30 тыс. км. А к 50 тыс. Км раскручивается кардан рулевого вала (от 3500 руб.).Вакуумный усилитель тормозов отказал, но после 2009 года в систему установили клапан с фильтром, и проблема исчезла.

Кузов и его лакокрасочное покрытие прочное. Но на автомобилях 2008-2009 годов выпуска на левом переднем крыле появилась трещина из-за ослабления металла в зоне приварки кронштейна, на котором установлен аккумулятор. Часто выходит из строя механизм складывания боковых зеркал (от 7500 руб.). Прогорает подогрев сиденья «спираль». Примерно раз в месяц зажигаются лампы ближнего света (60-200 руб.) И габаритов.

От дебюта до рестайлинга

Всего через два года после выпуска модели, в 2007 году, корейцы модернизировали SsangYong Kyron. Однако в этом нет ничего удивительного. Дизайн дебютанта был воспринят слишком вызывающе. На обновленном автомобиле упразднены три горизонтальных прорези под фарами, а решетка радиатора увеличена и оформлена в стиле Mercedes-Benz. Установлены разные бампера. Круглые противотуманки уступили место прямоугольно-продолговатым, а вместо задних фонарей в виде рыцарских щитов появились более традиционные.Салон остался практически без изменений — только центральную консоль отделали вставками «под карбон». Зато в линейке двигателей появилась бензиновая «четверка» объемом 2,3 литра (150 л.с.) и 4-диапазонная АКПП.

Вердикт

редактор:

— При покупке бывшего в употреблении Kyron желаю вам в будущем технически исправной и безотказной копии, так как велика вероятность купить кота в мешке. Понимаете — лотерея. Поэтому нужно максимально обезопасить себя от неприятностей.Для чего мы рекомендуем полную диагностику. И не стоит связываться с официальной службой. Статистика показывает, что на специализированных СТО работают самые грамотные мастера и диагносты SsangYong. И не нужно бояться ремонта или замены агрегатов первым владельцем. Главное, чтобы работа была выполнена качественно, ведь снаряд не попадает в одну воронку дважды.

Когда машина впервые появилась на российском рынке. Спустя почти два месяца мы получили эту машину на тест-драйв.

Сразу скажем: машина получилась интересной именно в рамках философии SsangYong, ведь раньше под этой корейской маркой мы видели только рамные машины … У них было много поклонников, своих достоинств, но, как сказал Сергей Об одном музыкальном коллективе Шнуров говорит: «Машина времени» застряла во времени. То же самое и с корейцами.

Новый Экшен — совсем другое дело. Это перспективный продукт, который сможет побороться за место под солнцем как в Европе, так и в России.Он идеально вписывается в парадигму современных автомобильных ценностей. Более того, теперь мы можем сказать, что SsangYong вырос до уровня, на котором принято «воспитывать адептов». Другими словами, поклонники этой марки впредь будут менять автомобиль, оставаясь в рамках предыдущей марки. Им теперь есть что изменить!

Какие современные автомобильные ценности присутствуют в Актионе?

Первые экономичные дизельные (а в будущем и бензиновые) двигатели. Пока в арсенале кроссовера только дизели (149 и 175 л.с.).Нам довелось испытать более мощную модификацию. Мотор понравился больше чем. В сочетании с механической коробкой он всегда оставляет запас под ногой, оставаясь динамичным, эластичным и отзывчивым.

Во-вторых, несущий кузов. Это снижает стоимость производства автомобиля, делает его более доступным в обслуживании и более практичным. Конечно, кто-то возразит, что каркасные кузова — это неиссякаемый запас прочности и проверенная временем геометрия. Но, с другой стороны, почему тогда даже такой мастер мира рамных вездеходов, как Nissan Patrol, в новом поколении тоже кроссовер? И есть ли повод для беспокойства: Action по-прежнему такой же высокий (хотя и ниже, чем у предшественника), у него короткие свесы — именно то, что нужно периодически съезжать с дороги.Сохранилась даже высокопрофильная резина, хотя в угоду моде опционально предлагается 18-дюймовый «молдинг». Также впечатляет превосходная продуманность конструкции кузова. Итак, передок практически весь пластиковый — бампер заканчивается почти на уровне оконной линии. Это означает, что в российских реалиях не должно быть коррозии и сколов.

Отдельная тема — наследие Mercedes-Benz. Известно, что эти два бренда являются давними партнерами. Немцы также приложили руку к разработке новых Aktions.Времена изменились: раньше корейцы гордились этим фактом, а теперь очень неохотно говорят и даже прячутся. Но тщетно. Ведь это именно тот пример, когда партнерство принесло ожидаемые результаты. SsangYong действительно успешно интегрируется в Европу. Например, даже дизайн для перспективного новичка разработало итальянское конструкторское бюро. Получилось неплохо, потому что, если вспомнить предыдущий экшен, то его оформление было очень на любителя. В этом случае машина по-хорошему нейтральна.

Знакомство начинается с первых километров пробок Санкт-Петербурга. Ни о каком резвом вождении не может быть и речи — нужно активно работать рычагом КПП. Коробка передач на первый взгляд далека от идеала — ходы нечеткие, порой даже при полностью отпущенном сцеплении рычаг не хочет попадать в нужное положение. Сразу скажу, полностью адаптироваться к переключению не получилось. Но когда пробки разрешились, можно было почувствовать потенциал дизеля.Ресивер — это то, что вам нужно! Тормоза тоже понравились — в меру информативность и четко с запасом.

В общем, если вспомнить прежний Актион, то он постоянно «плыл» по дороге, а огромный легкий и «пустой» руль делал больше трех оборотов, что явно неспособно к активным перестановкам. В новом кроссовере отсутствие рамы чувствуется с первых же колей метро — машина как будто похудела и теперь чувствует себя в оптимальной форме.Отдельное спасибо электроусилителю переменного усилия (взамен прежнего гидроусилителя), который позволил уменьшить количество оборотов и сделать рулевое колесо информативнее. Причем с увеличением скорости руль наполняется с достаточной силой, а не пустует, как раньше.

Причин для лучшего поведения в дороге — очень много. Сразу назову подвеску полностью независимую (плюс по комфорту), многорычажную (плюс по устойчивости), более низкий центр тяжести.Новый Aktion короче и ниже своего предшественника, он на 400 кг легче, а его передняя и задняя колея шире. В общем чистая арифметика!

Привыкнув к рулению новой машины, я как-то даже забыл, что пересел в кроссовер. Вроде бы непривычно высокая, да и посадка совсем другая, чем в легковом автомобиле, но и «грузовых» ощущений тоже нет. Спустя какое-то время я вспомнил, что машину собирали в России, на Дальнем Востоке. Большой козырь с точки зрения ценового позиционирования, но общий минус с точки зрения качества сборки и подгонки деталей.Но тут не к чему придраться!

Еще один интересный момент — внутреннее пространство. Несмотря на меньшую колесную базу, чем у предшественника, Aktion, как и раньше, остался одним из лидеров в этом классе. Сзади много места, а плоский пол и возможность регулировки угла наклона спинки заднего сиденья делают жизнь задних пассажиров веселой и беззаботной. По крайней мере, на время поездки.

А как насчет бездорожья? Кстати, предыдущий Актион не был серьезным вездеходом — блокировок дифференциала для него не было вообще, а уменьшенный запас хода предлагался только для двигателей с бензиновым мотором в паре с АКПП.Считалось, что тяговитый дизель все равно выйдет. Теперь на смену старым олдскульным схемам (задний привод и механически подключаемый передок) пришла электроника. Автомобиль по умолчанию переднеприводный — муфта сама передает момент на задние колеса. Есть имитация блокировки дифференциала (опять же электроника) — можно активировать вручную.

Большой ход подвески, неразрезной мост и надежная рамная конструкция сделали прежний Актион непробиваемым в его родной стихии — разбитых грунтовых дорогах.Конечно, на скорости 40 км / ч запаха комфорта не ощущалось — но эта машина создавалась не для комфорта. Новый Aktion обеспечивает необходимый уровень комфорта, если вы вообще можете ездить, не убивая подвеску. Но благодаря новой трансмиссии кроссовер чувствует себя на грязной грязной дороге с глубокими колеями и сырой почвой даже лучше, чем его предшественник. Объяснение этому опять же в дизайне. Автомобиль с задним приводом не предназначен для такой среды, а электроника делает многое.Конечно, в определенных пределах!

Одним словом, новый Актион — «ваш и наш». Вынуждены признать: первый кроссовер в исполнении SsangYong получился вполне достойным, а как он себя проявит в эксплуатации — покажет время.

Кстати, еще одна особенность новой машины, которая мне лично очень нравится: она не пытается «пыхтеть» и быть тем, чем не является. Да, на бездорожье он будет складываться перед Гранд Витара. Но по асфальту на нем передвигаться почти лучше, чем на стандартном классе Qashqai, давно обреченном на сравнение с самим собой.Что ж, то, что Aktion собран солиднее и качественнее Sportage, — не комплимент, а констатация факта. Но последнее не только в России.

Информация SsangYong New Action 2.0 D (175 л.с.)

Стоимость базовой комплектации составит 799 000 рублей, а топовая версия будет стоить 1 199 000 рублей. SsangYong New Actyon будет производиться на заводе Sollers Far East, где планируется выпускать до 10 000 таких машин в год.

Комплектация и цены ssangYong New Actyon *

Оборудование

Оригинал

Оригинал

Элегантность

Элегантность +

Элегантность +

АКПП 4WD

AT 4 WD

AT4 WD *

Стоимость, руб.

Климат-контроль

Электроусилитель руля

Подогрев передних сидений

Кожаная обивка сидений

Датчик дождя

Литые диски

Противотуманные фары

Сиденье водителя с электроприводом

Аудиосистема CD / MP3

* SsangYong New Actyon комплектуется 2-литровым турбодизелем мощностью 149 или 175 л.с.из. Покупатель может выбрать автомобиль с приводом 2WD, передающий 100% крутящего момента на переднюю ось, или 4WD, в котором крутящий момент распределяется в соотношении 50: 50.

Эксплуатация

    Стоимость ТО-1 — от 6 500 рублей

    Стоимость ТО-2 — от 12500 рублей

    Стоимость ТО-3 — от 20 500 рублей

    Стоимость КАСКО — от 38710 руб.

    Стоимость ОСАГО — от 3707 рублей

    Транспортный налог в год — 8750 руб.

  • Гарантийный срок — 2 года

    Технические характеристики SsangYong New Action 2.0 Д АТ

Кол-во дверей / мест

Длина мм

Ширина, мм

Высота, мм

Объем багажника, л.

Двигатель, объем, куб. См.

Дизель, 1998 г.

Мощность, л.с.п.

Крутящий момент, Нм при об / мин мин.

Динамика разгона до 100 км / ч, сек.

Максимальная скорость, км / ч

Трансмиссия

Автомат шестиступенчатая

Расход топлива, л.

Емкость топливного бака, л.

Мне удалось побывать в сборочном цехе завода «Соллерс — Дальний Восток». Поехал, посмотрел, сфотографировал, как собирают машины. Основной целью визита стал SsangYong New Actyon, автомобиль, запущенный в серийное производство на Приморском заводе.

Здесь собралось много людей, иностранных гостей, прессы, руководство завода и многие другие.
Чтобы никого не потерять, всех распределили по группам и назначили личного гида.
1.

Фотография была моей целью, поэтому я немедленно отбился от своей группы. Гид много рассказывал о каждом этапе сборки, отвечал на любые вопросы, жалею, что покинул группу, т.к. подписи к фотографиям нигде не найти%)

Новая линия:
2.

Кузов без наполнения
3.

ждет на линии
4.

Такие минитракторы доставляют все виды запчастей по всему заводу
5.

Среди сотрудников было много девушек
6.

Надпись на табличках характеризует рабочий процесс
7.

видимо они занимаются подсборкой моторного отсека
8.

Колеса готовы занять их место
9.

Собсно установка
10.

11.

За что отвечает этот компьютер, не разобрался
12.

Крутят что-то там
13.

Новый конвейер
14.

Сотни метров проводов и широкий выбор электрических аксессуаров
15.

Этот парень ведет лифт
16.

А этот ставит двигатель в машину
17.

18.

19.

20.

21.

Человеческий труд
22.

С помощью подъемника рабочие устанавливают кузов
23.

и исправить
24.

Иностранные гости внимательно относятся к процессу сборки
25.

26.

Собранные автомобили выстроены в очень яркую мастерскую, мощные лампы позволяют увидеть, есть ли на краске царапины, сколы или другие косяки
27.

Последний этап. Авто готовится к компьютерной диагностике. Коробка
28.

Диагностика
29.

Вагоны с полной отделкой
30.

Ну вот и все, что видел в продакшене.

В конце экскурсии все наконец-то собрались плотным кольцом вокруг новой машины, покрытой белым брезентом. С докладом выступил Александр Владимирович Корнейчук — генеральный директор ООО «СОЛЛЕРС-Дальний Восток».
31.

По окончании торжественного представления гостям было представлено световое шоу. Лучи окрашивали машину в разные цвета, красиво оформляли на ней всевозможные изображения..
32.

После этого машину дали на разборку всем желающим.
33.

NEW Actyon — первый кроссовер SsangYong с несущим кузовом и системой полного привода
34.

Это уже пятая модель, производство которой налажено на заводе во Владивостоке наряду с Rexton, Kyron, Actyon, Actyon Sports.
35.

Продажи новой модели Actyon начнутся в феврале, первые автомобили появятся у дилеров на Дальнем Востоке.
36.

В России NEW Actyon будет доступен с двумя модификациями дизельного двигателя мощностью 175 л.с. и 149 л.с. Кроме того, NEW Actyon оснащается 6-ступенчатой ​​механической или 6-ступенчатой ​​автоматической коробкой передач с функцией ручного переключения.

Цены на базовую версию SsangYong NEW Actyon начинаются от 799 тысяч рублей с двигателем 149 л.с., МКПП и передним приводом.

Самой популярной ожидается модификация с двигателем 149 л.с., АКПП и полным приводом, доступная от 939 тысяч рублей.

SsangYong Motor Company — южнокорейский производитель автомобилей (автомобилей) со штаб-квартирой в Сеуле. Sang Yong в переводе с русского означает «два дракона», компания занимает третье место среди корейских автопроизводителей по количеству проданных автомобилей.

Официальной датой основания в истории компании SsangYong считается октябрь 1954 года, на момент своего появления компания называлась Hadonghwan Motor Company. Первой продукцией автопроизводителя стали лицензионные Willys (армейские внедорожники), поставляемые в южнокорейскую армию.Благодаря постоянным заказам военных компания Sanyeng (есть еще транскрипции Sang Yeng, Sangeng или Ssangyong) быстро достигла финансового успеха и постепенно расширила ассортимент выпускаемой техники. В 60-70-е годы компании удалось наладить выпуск грузовых автомобилей, автобусов и спецтехники.

В 1967 году в рамках партнерства с Shinjin jeep Motor Co., Ltd. заключены контракты на поставку автобусов во Вьетнам.

1974, Hadonghwan Motor Company становится совладельцем джипа Motor Shinjin.
В 1976 году компания сменила название на Dong-A Motor. Ведется разработка новых внедорожников, рассчитанных на перевозку 4-6 человек с использованием дизельных двигателей.
В 1979 году в Пхёнтеке открылся новый завод по сборке автомобилей.
1983 г. — покупка бренда Korando у компании Geohwa Co., Ltd с последующим поглощением компании Geohwa.

В 1986 году Dong-A Motor перешла под контроль Ssangyong Business Group, а в 1988 году получила свое нынешнее название SsangYong Motor. В модельном ряду появляется Korando Family — созданный на платформе японского Isuzu Trooper.
В 1991 году предприятия SsangYong заключили договор о техническом сотрудничестве с Mercedes-Benz AG (разработка новых бензиновых двигателей).
В 1993 году Mercedes-Benz AG стала одним из основных акционеров Ssang Yong Motors, вторым совладельцем является китайская компания SAIC Motor. Mercedes AG и Sanyeng Motors присоединяются к техническому союзу. На данном этапе истории Sang Yong все автомобили производятся под контролем представителей Mercedes-Benz.

В

машинах SsangYong используются двигатели, коробки передач и многие конструкторские решения и технологии немецкого автомобильного гиганта.Запуск внедорожника SsangYong Musso.

В 1995 году в Европе начались продажи корейских автомобилей Sang Yong, первенцем стала модель Istana — точная копия микроавтобуса Mercedes-Benz MB 100, выпускавшегося с 1988 по 1995 год.
В 1996 году появляется новый Korando, компания сертифицирует свою продукцию в соответствии с международными стандартами ISO.
В 1997 году в модельном ряду Sanyeng появляется представительский седан Chair на базе Mercedes-Benz W124.
В 1998 году компания перешла под контроль Daewoo Group, но ненадолго.Два года спустя, в 2000 году, Ssang Yong снова стала независимой структурой.
В 2001 году стартует производство внедорожной новинки Rexton.

В 2002 году пикап SsangYong Musso Sports запущен в серийное производство.
В 2003 году были представлены седан Chair нового поколения и минивэн Rodius с неоднозначным дизайном.
Внедорожник SsangYong Kyron дебютирует в 2005 году.
В 2006 году появилась еще одна новинка от Sang Yong Actyon.

В 2008 году состоится премьера первого кроссовера в модельном ряду SsangYong — C200 Concept (всего через два года, после смены названия на Korando, машина дойдет до покупателей).В том же году менеджмент компании объявил о банкротстве, после реструктуризации компания была выставлена ​​на продажу. 12 августа 2012 года SsangYong Motor был приобретен индийским концерном Mahindra & Mahindra Limited.
Производство внедорожников Sanyeng для российских покупателей осуществляется на заводах Sollers в Набережных Челнах и Владивостоке.

Сегодня в России и странах СНГ автомобили Ssang Yong пользуются устойчивым спросом. В автосалонах России представлены модели корейско-индийского производителя: Actyon, Kyron, Rexton и пикап Actyon Sport.Украинским покупателям доступны
Korando (близнец российского Actyon), Actyon и Actyon Sports, New Actyon Sports, New Kyron и Rexton II. Возможно, в ближайшее время к корейским внедорожникам, продаваемым на постсоветском пространстве, добавятся представительские седаны SsangYong.

Где собирают автомобили Санг Йонг Кайрон. SsangYong Kyron.

Svangen SsangYong Kyron (Сантенг Кайрон) начали производить в Корее в 2005 году. Автомобиль отличался оригинальным внешним видом, автором которого стал британский дизайнер Кеннет Гринли.

Автомобиль имел рамную конструкцию, Кайронов для корейского рынка имел независимую заднюю подвеску и семисторонний салон, а экспортные версии имели неразрезной задний мост и пять мест в салоне. Привод полный, с жестко подключаемыми передней и нижней трансмиссией, в Корее предлагались и заднеприводные модификации.

SsangYong Kyron установил лицензионные «мерседесовские» силовые агрегаты: четырехцилиндровый турбодизель объемом 2,0 литра и пятицилиндровый объемом 2 литра.7 литров (на российский рынок такие машины не поставлялись). Трансмиссия — пятиступенчатая, механическая или автоматическая.

В 2007 году был проведен рестайлинг модели: «Santeng Kayron» получил более гармоничный дизайн, немного измененный салон и бензиновый двигатель объемом 2,3 литра мощностью 150 л. из. В сочетании с «механикой» или четырехступенчатым «автоматом». В 2009 году на некоторые версии модели начали устанавливать новую шестиступенчатую автоматическую коробку передач.

Кайроны для российского рынка с 2006 года собирались на заводе Sollers в Набережных Челнах, а в конце 2009 года производство было перенесено во Владивосток.Цены на внедорожник начинались с 800 тысяч рублей (в 2010 году).

В Корее SsangYong Kyron сняли с производства в 2011 году, а сборка автомобилей во Владивостоке продолжалась до 2014 года (небольшая партия монолитных автомобилей пришла на российский рынок по окончании срока службы конвейера). Лицензионная копия модели была произведена в Китае под названием.

Sanneng Cairron Таблица двигателя автомобиля

Когда машина только появилась на российском рынке. Спустя почти два месяца мы получили эту машину на тест-драйв.

Сразу скажем: машина оказалась интересной именно в рамках философии SsangYong, ведь раньше под этой корейской маркой мы привыкли видеть исключительно рамные машины. У них было много поклонников, своих достоинств, но, как говорит об одной музыкальной группе Сергей Шнуров: «Машина времени» застряла во времени. К корейцам относился примерно так же.

Новый Action — это нечто совершенно иное. Это перспективный продукт, способный побороться за место под солнцем и в Европе, и в России.Он отлично вписывается в парадигму современных автомобильных ценностей. Более того, теперь можно сказать, что SsangYong Doros до уровня, на котором принято «культивировать адептов». Другими словами, любители этой марки отныне меняют автомобиль, оставаясь в рамках предыдущей марки. Им теперь есть что передать!

Что из современных автомобильных ценностей присутствует в актоне?

Первые, экономичные дизельные (а в перспективе — и бензиновые) двигатели. Пока что в арсенале кроссовера только дизель (мощностью 149 и 175 л.с.).Пришлось одолжить более мощную модификацию. Мотор понравился больше чем. В сочетании с ручным боксом он всегда оставляет под стопой запас, оставаясь и динамичным, и упругим, и по возрасту.

Во-вторых, переноска тела. Это позволяет удешевить производство автомобиля, делает его доступнее в обслуживании и практичнее. Конечно, кто-то возразит, что рамы — это неисчерпаемый запас прочности и проверенная геометрия. Но, с другой стороны, почему даже такой мастадонт мира каркасных вездеходов, как Nissan Patrol, в новом поколении тоже является кроссовером? Да и стоит ли переживать: Экшен у всех такой же высокий (хоть и ниже предшественника), просадки у него короткие — самое главное периодически съезжать с дороги.Сохранились даже высокопрофильные шины, хотя в пользу моды опционально предлагается 18-дюймовая «литая». Впечатляющий и отличный дизайн кузова. Итак, передок практически весь пластик — бампер заканчивается почти на уровне линии окон. Значит, без коррозии и сколов, неизбежных в российских реалиях.

Отдельная тема — Heritage Mercedes-Benz. Известно, что эти две марки являются давними партнерами. Немцы тоже приложили руку к разработке новых действий. Времена изменились: раньше корейцы этим фактом гордились, а теперь говорят довольно неохотно и даже скрывают.И зря. Ведь это именно тот пример, когда партнерство принесло те результаты, которые от него ожидали. SsangYong действительно успешно интегрировался в Европу. Дескать, даже дизайн для перспективного новичка разработало итальянское конструкторское бюро. Получилось хорошо, потому что если вспомнить прежний Экшен, то его дизайн просто очень полюбился. В этом случае автомобиль стоит на хорошей нейтрали.

Знакомство начинается с первых километров по пробкам Санкт-Петербурга.Я не могу ни на что другое ездить — нужно активно работать рычагом КПП. На первый взгляд коробка далека от идеала — ходы нечеткие, иногда даже при полностью нажатой муфте рычаг не хочет становиться в нужное положение. Сразу скажу полностью адаптироваться к переключению так и не вышло. Но когда движение разрешилось, можно было почувствовать потенциал дизельного двигателя. Ресивер то, что нужно! Тормоза понравились — в меру информативность и явно с запасом.

В общем, если вспомнить былые действия, то он постоянно «плыл» по дороге, а огромные размеры легкого и «пустого» руля совершали переживание перед остановкой трех внешних оборотов, которые явно не в состоянии активно перестроить. В новом кроссовере отсутствие рамы чувствуется с первого пути метро — машина как будто сбросила вес и теперь чувствует себя в оптимальной форме. Отдельное спасибо электроцессору с переменным усилием (вместо прежнего гидроагента), который позволил уменьшить количество оборотов и сделать руль более информативным.Причем с увеличением скорости руль переливается адекватным усилием, и не будет пустовать как раньше.

Причины лучшего поведения на ходу — предварительный набор. Подвеску назову полностью независимой (плюс к комфорту), многомерностью (плюс к устойчивости), более низким центром тяжести. Новый строй короче и ниже предшественника, легче на 400 кг., А передняя и задняя колея шире. В общем чистая арифметика!

Обычный для рую Ньюмаавтомобиль, я как-то даже забыл, что пересел на кроссовер.Вроде бы непривычно высокая, да и посадка совсем другая, чем в шкафу, но и ощущений «груза» не наблюдается. Спустя какое-то время я вспомнил, что машину собирали в России, на Дальнем Востоке. Большой козырь в плане ценового позиционирования, но обычный минус по качеству сборки и подгонки деталей. Но это не зачем!

Еще один любопытный момент — внутреннее пространство. Несмотря на меньшую, чем у предшественника, колесную базу, Acton как был одним из лидеров в этом классе, так и остался.Места за спиной полно, а ровный пол и возможность регулировки угла наклона спинки делают жизнь задних пассажиров веселой и беззаботной. По крайней мере, во время поездки.

А что по бездорожью? К слову, прежний экшен не был серьезным вездеходом — блокираторы тормозов для него вообще не предусматривались, а уменьшенный ряд предлагался только для моторов с бензиновым двигателем в паре АКПП. Считалось, что аварийный дизель вытащит и так.Теперь на смену прежним олдскульным схемам пришла электроника (задний привод и механически подключаемый передний). По умолчанию в автомобиле передний привод — муфта сама передает момент на задние колеса. Есть имитация блокировки дифференциала (опять же электроника) — можно активировать вручную.

Длинные ходы подвески, неразрезной мост и надежная конструкция рамы сделали прежнее действие непонятным в его родной стихии — разбитых дорогах.Конечно, на скорости 40 км / ч комфортом и не пахло — но это не для комфорта и этот автомобиль создавался. Новый механизм обеспечивает необходимый уровень комфорта до тех пор, пока вы не сможете ехать, не убивая подвеску. Но благодаря новой трансмиссии кроссовер ощущается как грязный раствор с глубокими колеями и опасной почвой даже лучше, чем предшественник. Объяснение этому — опять же в дизайне. Автомобиль с задним приводом не создан для окружающей среды, а электроника позволяет многое.В определенных, конечно, пределах!

Одним словом, новая акция — «твоя и наша». Выпустили признать: первый кроссовер в исполнении SsangYong был вполне приличным, а как он проявит себя в процессе эксплуатации — покажет только время.

Кстати, еще одна особенность нового автомобиля, которая лично мне очень нравится: он не пытается «влиять» и быть тем, чем не является. Да, на бездорожье он спасет раньше Grand Vitra. А вот по асфальту на нем передвигаться вряд ли лучше, чем по эталону для класса Casca, который давно уже не замечает всех, кто с ними сравнивает.Что ж, то, что экшен собран и доброжелателен, и болтовня, чем Sportage, не комплимент, а констатирующий факт. Но последний собирается только в России.

Информация SSANGYONG NEW ACTION 2.0 D (175 л.с.)

Стоимость базовой комплектации составит 799 000 рублей, а топовой версии — 1199 000 рублей. SsangYong New Actyon будет производиться на Дальневосточном заводе «Соллерс», где планируется выпускать до 10 тысяч таких автомобилей в год.

SSANGYONG NEW ACTIN * Цены и цены *

Оборудование

Оригинал.

Оригинал.

Элегантность

Elegance +.

Elegance +.

АТ 4WD.

AT 4 WD.

AT4 WD. *

Стоимость, руб.

Климат-контроль

Электроусилитель руля

Подогрев передних сидений

Кожаная обивка сидений

Датчик дождя

Литые диски

Противотуманные фары

Электропривод сиденья водителя

Аудиосистема CD / MP3

* SsangYong New Actyon комплектуется двухлитровым турбодизелем мощностью 149 или 175 л.из. На выбор покупателя предлагается привод 2WD, передающий 100% крутящего момента на переднюю ось, или 4WD, в котором крутящий момент распределяется в соотношении 50: 50.

Эксплуатация

    Стоимость ТО-1 — от 6 500 рублей

    Стоимость ТО-2 — от 12 500 рублей

    Стоимость ТО-3 — от 20 500 рублей

    Стоимость — от 38 710 руб.

    Стоимость ОСАГО — от 3707 рублей

    Транспортный налог в год — 8 750 руб.

  • Гарантийный срок — 2 года

    ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ SSANGYONG NEW ACTION 2.0 Д АТ

Кол-во дверей / мест

Длина, мм.

Ширина, мм.

Высота, мм.

Объем багажника, л.

Двигатель, объем, куб. см.

Дизель, 1998 г.

Мощность, л.с.

Крутящий момент, нм при об. мин.

Динамика разгона до 100 км / ч, сек.

Максимальная скорость, км / ч

Трансмиссия

Автомат шестиступенчатая

Расход топлива, л.

Емкость топливного бака, л.

Мне удалось побывать в сборочном цехе завода «Соллерс — Дальний Восток». Посмотрела посмотрела, посмотрела как собирают машины. Основной целью визита был этот SsangYong New Actyon, автомобиль, поставленный в серийный выпуск на Приморском заводе.

Людей не хватало, были иностранные гости, пресса, руководитель завода и многие другие.
Чтобы никого не запутать, всех разделили по группалам и поставили личный гид.
1.

Моей целью было фотографирование, поэтому я сразу отбил свою группу. Гид много рассказывал о каждом этапе сборки, отвечал на любые вопросы, жалею, что покинул группу, т.к. Подписи к фото А теперь бери сейчас.%)

Новая линия:
2.

Кузов без набивки
3.

ждут своей очереди
4.

Такие минитракторы развозят по заводу всевозможные запчасти.
5.

Среди сотрудников было много девушек
6.

Надпись на знаках характеризует рабочий процесс
7.

видимо занимаются предварительным моторным отсеком
8.

Колеса готовы занять их место
9.

Установка Собсно
10.

11.

За какие ответы этот компьютер я не понял
12.

Получается что-то там
13.

Новый конвейер
14.

Сотни счетчиков проводов и множество различных видов поражения электрическим током
15.

Этот парень управляет лифтом
16.

А этот ставит двигатель в машину
17.

18.

19.

20.

21.

Человеческий труд
22.

С помощью подъемника рабочие устанавливают кузов
23.

и закрепите
24.

Иностранные гости внимательно относятся к процессу сборки
25.

26.

Собранные автомобили построены в очень светлой мастерской, мощные лампы дают посмотреть, есть ли царапины на краске, сколы и еще какие-то косяки
27.

Последний этап. Авто готовится в компьютерной диагностике бокс
28.

Диагностика
29.

Полностью готовые вагоны
30.

Ну вот и все, что видел в продакшене.

По окончании экскурсии все наконец собрали в плотное кольцо вокруг новой машины, покрытой белым полотном. Выступление сохранил Корнейчук Александр Владимирович — генеральный директор ООО «Соллерс-Дальний Восток».
31.

По завершении торжественной речи гостям представили световое шоу. Лучи окрашивали машину в разные цвета, рисовали на ней всякие картинки, красиво ..
32.

После машины был предоставлен в замешательство всех.
33.

New Actyon — первый кроссовер ssangyong с несущим кузовом и полным приводом
34.

Это пятая модель, производство которой налажено на заводе во Владивостоке наряду с Rexton, Kyron, Actyon, Actyon Sports.
35.

Продажи новой модели New Actyon стартуют в феврале, а первые автомобили появятся у дилеров Дальнего Востока.
36.

В России New Actyon будет доступен с двумя версиями дизельного двигателя мощностью 175 л.с. и 149 л.с. Кроме того, New Actyon комплектуется 6-ступенчатой ​​механической или 6-ступенчатой ​​автоматической коробкой передач с функцией ручного переключения.

Цены на базовую версию SsangYong New Actyon стартуют с отметки 799 тысяч рублей с двигателем 149 л.с., МКПП и передним приводом.

Самая популярная доработка ожидается с двигателем 149 л.с., АКПП и полным приводом от 939 тыс. Руб.

SSAngyong Kyron — южнокорейский кроссовер. Автомобиль выпускается с 2005 года. Изначально для российского рынка Cairon собирали в Набережных Челнах, а с декабря 2009 года — во Владивостоке (это была первая модель нового предприятия «Соллерс — Дальний Восток»).

Kyron не случайно получил «внедорожные корни», ведь работа с внедорожниками можно сказать в крови SsangYong. Во время войны компания Donghwan Motor занималась производством военных внедорожников между Северной и Южной Кореей.Через пару лет компания сменила название на SsangYong и продолжила заниматься автомобильной промышленностью, но уже гражданской. Постепенно она стала покупать другие корейские компании, создав автомобильную монополию. Первым гражданским внедорожником концерна SsangYong стал Korando Family, имевший место. Этот предмет впоследствии занял Кайрон.

Частично предшественник Kyron, дизайн которого был разработан Кеном Гринли (он занимался разработкой дизайна для Kyrona). Кроме того, лицензионный двигатель MERCEDES-BENZ был установлен на Musso, который был вспомогательным, и на Kyron.Однако Musso — полноценный внедорожник, а Cairon создавался, прежде всего, как городской кроссовер. Платформа для него, которая выпускается с 2001 года (сам Rexton построен на базе Mercedes-Benz M-класса).

Через год после дебюта Kairon в продажу поступил SsangYong Actyon. Эти две машины являются одноклассниками и отличаются только дизайном кузова и салона. SsangYong Actyon выпускался с 2006 по 2011 год, но его производство было закрыто из-за повышенного спроса на Cairon. Однако Кайрону не суждено было остаться одному.В том же 2011 году на мощностях Дальневосточного завода «Соллерс» возобновлено производство собрата по классу kairon — обновленного SsangYong New Actyon.

Технические характеристики

Кузов автомобиля имеет рамную конструкцию, что дает массу преимуществ. Каркас выполнен из высокопрочного металла, добавляет автомобилю веса, тем самым нивелируя вибрацию внутри кабины при движении. Кроме того, в случае столкновения кузов серьезно защищен от деформации.

Еще один плюс внедорожных качеств машины — это конструкция крыльев. Инженерам SsangYong удалось спроектировать их таким образом, что даже при движении по грязи стекла Kairon надежно защищены и остаются чистыми.

На российском рынке для кроссовера предлагается 2,3-литровый бензиновый мотор, а также 2,0-литровый турбодизель — особая гордость корейца, унаследовавшего от Mercedes. На других рынках дизельный Kyron также встречается в 2,7-литровом исполнении.

Кен Гринли, дизайнер Kairon, признался, что при создании первой версии автомобиля средневековая культура была слишком увлечена. В результате интерьер получил много изгибов в оформлении инструментов, а рукоятка ручного тормоза в целом была похожа на эфесский меч. Столь нестандартный внешний вид Kairon показался маркетологам компании слишком вызывающим и «успокоил» рестайлингом.

Изначально Cayron собиралась на заводе в Набережных Челнах, где одновременно производили автомобиль.

В любой, даже самой богатой комплектации Kyron, штатной магнитолы нет. Его установкой придется разбираться с дилером или владельцем самостоятельно.

Плюсы и минусы

По сути, Suzuki Grand Vitara можно считать ближайшим конкурентом корейского кроссовера. При аналогичных энабаритах кайрон может похвастаться более просторным салоном и возможностью регулировки руля (отсутствие этой регулировки на Grand Vitara — парадокс, который не объясняется).

Еще один плюс в копилку Кайрона — большой объем багажника, который можно увеличить, если сложить задние сиденья (до 1085 литров).

Из минусов можно выделить отсутствие режима помощи при спуске с горы, что характерно для любого современного внедорожника.

Наконец, совершенно неожиданный недостаток — это стоимость обслуживания автомобиля в России. Несмотря на свое корейское происхождение, цены у официальных дилеров совсем не «корейские».

В целом SsangYong Kyron и Suzuki Grand Vitara — это автомобили разной специфики. Kayron предлагает обладателю уверенной тяги к низким оборотам (в версии с дизелем) комфорт и надежность даже на бездорожье.В свою очередь Vitara более шустрый автомобиль, в нем трясется и чувствуется прохождение каждого UHAB, что добавляет драйва во время загородного путешествия.

Целевая аудитория

SsangYong Kyron.
— выбор любителей комфортного передвижения по городу и регулярных деревенских пикников. В меру мощный, надежный и вместительный, он отлично подойдет для небольшой семьи. Также не стоит забывать, что Cayron — флагман линейки SsangYong за очень разумные деньги.

Награды и номера

В 2006 году британский журнал 4×4 включил SsangYong Kyron в список лучших внедорожников года.Автомобиль занял 6 позиций с результатом 29 баллов (для сравнения, у победителя Jeep Commander — 39).

В 2007 году Cayron вошел в список претендентов на звание «Автомобиль года» в Европе, но ни финальной, ни тем более до победы ему не досталось.

25 марта 2010 года завод «Соллерс — Дальний Восток» торжественно отметил сданный с конвейера тысячный каирон. Всего в 2010 году в России было продано 1548 автомобилей SsangYong Kyron.

История вопроса

Введение

Вакцинация младенцев — одна из наиболее важных стратегий борьбы с инфекционными заболеваниями во всем мире.Однако уже четыре десятилетия известно, что эффективность детских вакцин в странах Африки к югу от Сахары ниже, чем в странах с высоким уровнем доходов [1], и что интеркуррентные инфекции, такие как малярия, могут влиять на реакцию антител [2], [3]. Например, эффективность живой аттенуированной противокоревой вакцины обычно превышает 90% в Европе и Северной Америке [4] — [6], но ниже 70% в Западной Африке [7] — [9].

В странах Африки к югу от Сахары инфицирование вирусом герпеса Эпштейна-Барра (EBV) и цитомегаловирусом (CMV) обычно происходит в младенчестве [10] — [12], после чего у них развивается пожизненная инфекция [13], [14].Хотя инфекция обычно протекает бессимптомно, оба вируса оказывают сильное воздействие на популяции лимфоцитов, участвующие в вакцино-опосредованном иммунитете. ВЭБ инфицирует В-клетки, и во время острой инфекции может быть инфицировано до 50% В-клеток [15]. В то время как инфекция ВЭБ обычно протекает бессимптомно у здоровых людей, она может вызывать тяжелое заболевание у лиц с ослабленным иммунитетом и в сочетании с хромосомными транслокациями вызывает лимфому Беркитта лимфому Беркитта у младенцев, чья иммунная система подавлена ​​малярией [16], [17].В отсутствие заболевания В-клетки, инфицированные ВЭБ, накапливают относительно большое количество мутаций, что предполагает, что ВЭБ может влиять на компартмент В-клеток даже при отсутствии клинического заболевания [18]. Влияние инфекции ВЭБ на реакцию В-клеток на вакцины или сопутствующие инфекции неизвестно.

В отличие от ВЭБ, ЦМВ оказывает сильное влияние на Т-клетки, хотя Т-клетки не являются основной мишенью для ЦМВ-инфекции [19]. Популяции Т-клеток у лиц, инфицированных ЦМВ, демонстрируют значительно более высокие уровни дифференцировки [20] — [23], даже среди младенцев, которые все еще получают детские прививки [24].Эти эффекты меняются с возрастом, поскольку индуцированная ЦМВ дифференцировка у пожилых людей связана с уменьшением субпопуляций наивных Т-клеток и плохим ответом на вакцины [23], [25], но у инфицированных младенцев нет таких доказательств снижения количества наивных Т-клеток. пула или ассоциированного с ЦМВ снижения Т-клеточного ответа на противокоревую вакцину [26].

Полисахаридные вакцины стимулируют В-клетки независимо от Т-клеток, что позволяет предположить, что они могут быть особенно уязвимы для модуляции EBV. Хотя полисахарид менингококка не вызывает стойкого иммунитета при введении до четырех лет [27], ВОЗ по-прежнему рекомендует вакцинацию независимо от возраста для сдерживания вспышек менингококкового менингита, которые периодически охватывают «пояс менингита» к югу от Сахары [28], [29] ] и поэтому он остается ценным инструментом в области детского здоровья.

Напротив, живая аттенуированная противокоревая вакцина индуцирует широкий спектр Т-клеточных и антительных ответов [30], [31], поэтому маловероятно, что она будет настолько уязвимой для какого-либо одного механизма модуляции.

Поскольку инфицирование ЦМВ и ВЭБ в раннем возрасте и относительно низкая эффективность вакцины характерны для стран Африки к югу от Сахары, мы предположили связь между инфекцией ЦМВ и ВЭБ в младенчестве и снижение ответа антител на вакцины. Поэтому мы количественно оценили их влияние на реакцию антител на полисахаридную вакцину против Neisseria meningitidis (менингококк) и живую аттенуированную противокоревую вакцину.Мы набирали младенцев из постоянной когорты в пригородном районе Гамбии и вводили вакцины в возрасте девяти месяцев. Двумя месяцами позже мы сравнили ответы вакцины на антитела младенцев, инфицированных CMV и / или EBV, с теми, которые остались неинфицированными.

Материалы и методы. Объекты и вакцинация.

Младенцев набирали при рождении из родильного отделения Поликлиники Сукута. Информированное согласие было получено от их матерей и подтверждено подписью или отпечатком большого пальца.Набор был ограничен здоровыми одинокими детьми с массой тела при рождении не менее 1,8 кг и отсутствием врожденных аномалий, матери которых не были госпитализированы во время беременности или родов.

Район, обслуживаемый поликлиникой Сукута, пригородный, население характеризуется низким доходом и многолюдным жильем. Грудное вскармливание обычно продолжается и до второго года жизни, и 50% младенцев инфицированы ЦМВ к 10-недельному возрасту [10]. ВИЧ-статус испытуемых был неизвестен, но распространенность среди взрослого населения в регионе была ниже 2.5% на момент исследования [32], поэтому маловероятно, что это будет значительным искажением результатов этого исследования. Риск заражения малярией низкий [33], и за последние 7 лет не было зарегистрировано ни одного случая заболевания корью. На момент вакцинации дети не были клинически больны, и во время исследования не было вспышек кори, менингита, респираторно-синцитиального вируса или ротавируса.

Все испытуемые получили детские прививки в соответствии с Расширенной программой иммунизации, которая включала прививку живым аттенуированным штаммом вируса кори Эдмонстон-Загреб (Институт сыворотки Индии) через девять месяцев.Кроме того, всех младенцев вакцинировали 50 мкг капсулярного полисахарида менингококка подтипов А и С (Санофи-Пастер) также в возрасте девяти месяцев. Все младенцы получили вторую дозу конъюгированной вакцины С против менингококка (любезно подаренная Wyeth-Lederle) в возрасте от трех до четырех лет для обеспечения постоянной защиты.

Исследование было одобрено этическим комитетом правительства Гамбии / MRC.

График отбора проб

Пуповинная кровь была собрана у 224 новорожденных при рождении, а гепаринизированная плазма хранилась.Через девять месяцев 1 мл крови собирали в пробирку для отделения сыворотки (Becton-Dickinson) для сбора сыворотки от 194 младенцев. Через одиннадцать месяцев у 182 субъектов было собрано 4 мл крови для измерения сывороточных антител, а полные лабораторные данные были доступны для 178 субъектов (рис. 1). Потеря возможности последующего наблюдения в основном была связана с миграцией (46%) или отказом от крови (18%). Все образцы плазмы и сыворотки хранили при -50 ° C или ниже и подвергали не более чем трем циклам замораживания-оттаивания в ходе исследования.

10.1371 / journal.pone.0014013.g001 Рисунок 1

Дизайн исследования.

A Дизайн исследования, показывающий время, в которое собирались образцы, проводились серологические исследования на ВЭБ и ЦМВ, вводились вакцины и измерялись вакцино-специфические ответы. B Число младенцев в когорте и участвовавших в анализе, а также число инфицированных EBV и CMV в возрасте девяти и одиннадцати месяцев.

Диагностика EBV и CMV

Поскольку многие образцы плазмы пуповинной крови содержали значительные уровни материнского анти-EBV и CMV IgG, невозможно было поставить диагноз через девять или одиннадцать месяцев исключительно на серостатусе IgG.

Когда младенцы получали вакцины против кори и менингококка в девять месяцев, младенцы классифицировались как инфицированные, если они соответствовали одному из двух критериев: 1 / вирус-специфические уровни IgG превышали уровни в их пуповинной крови или 2 / обнаруживаемый уровень вирус-специфический IgM. Младенцы были классифицированы как неинфицированные, если они соответствовали одному из трех критериев: 1 / вирус-специфические уровни IgG и IgM не были обнаружены во время отбора проб, 2 / вирус-специфические уровни IgG и IgM не были обнаружены через одиннадцать месяцев, так как младенцы инфицированы в через девять месяцев ответ антител будет наблюдаться к одиннадцати месяцам, или 3 / вирус-специфические уровни IgG будут обнаруживаться, но ниже уровней пуповинной крови через девять месяцев, в то время как уровни IgM превращаются из неопределяемых в обнаруживаемые между девятью и одиннадцатью месяцами.

Через два месяца после вакцинации против кори и менингококка, в возрасте одиннадцати месяцев, младенцы были классифицированы как инфицированные, если они соответствовали одному из трех критериев: 1 / вирус-специфические уровни IgG превышали уровни в их пуповинной крови, 2 / если они имели определяемые уровни вирус-специфических IgM, или 3 /, если они были классифицированы как инфицированные через девять месяцев. Младенцы были классифицированы как неинфицированные, если они соответствовали одному из трех критериев: 1 / вирус-специфические уровни IgG и IgM были неопределяемыми через девять месяцев, а уровни IgM оставались неопределяемыми через одиннадцать месяцев, или 2 / вирус-специфические уровни IgG и IgM были неопределяемыми. в одиннадцать месяцев.

Младенцы, для которых не мог быть соблюден ни один из вышеперечисленных критериев, не были классифицированы.

Уровни вирус-специфических антител измеряли с использованием ETI-VCA-G и ETI-EBV-M обратного ELISA (диасорин), которые определяют IgG и IgM соответственно к вирусному капсидному антигену (VCA). Инфекцию ЦМВ диагностировали с помощью ELICYTOK-G Plus ELISA (диасорин) для обнаружения IgG и ETI-CYTOK-M Reverse Plus (диасорин) или цитомегаловирусного IgM CAPTIA ™ ELISA (Trinity Biotech) для обнаружения IgM.

Диагноз воздействия малярийных паразитов

Воздействие малярии оценивалось путем тестирования на наличие антител IgG, специфичных к двум поверхностным антигенам мерозоитов, апикальному мембранному антигену 1 (AMA1) [34] и двум аллельным типам поверхностного антигена мерозоитов 2 (MSP2). [35] с использованием метода ELISA, как описано ранее [36].Образцы классифицировались как серопозитивные, если показание оптической плотности превышало 3 стандартных отклонения от среднего значения, полученного при тестировании 20 сывороток неиммунных туристов, посещающих Гамбию [33].

Измерение ответов на вакцины

Ответы антител на корь и менингококк измеряли с использованием образцов сыворотки, собранных в одиннадцатимесячном возрасте. Ответы на менингококк количественно оценивали с помощью ELISA, адаптированного из ранее опубликованных протоколов [37]. Стандарты были приготовлены из контрольной сыворотки CDC 1992 (NIBSC) в 1 / 100 для менингококка A и 1 / 200 для менингококка C, и для каждого микропланшета было выполнено восемь удвоенных разведений препаратов в трех экземплярах, что позволило получить результаты. выражается в мкг мл -1 .

Ответ антител против кори измеряли с помощью анализа ингибирования антител к гемагглютинину (HAI) [38] и калибровали по второму стандарту ВОЗ. Чувствительность анализа составляла 15,6 мМЕ, а минимальное определяемое значение — 31,2 мМЕ. Результаты выражены в виде титра log 2 , при котором гемагглютинация не наблюдалась.

Оценка вирусной нагрузки EBV

Образцы были взяты у 40 из 43 EBV-серопозитивных младенцев в возрасте одиннадцати месяцев. Аликвоты по 200 мкл крови центрифугировали при 2000 g в течение 5 мин, плазму удаляли и ДНК выделяли в 50 мкл с использованием реагентов DNA Mini Kit (Qiagen).Положительный контроль ДНК EBV экстрагировали из клеток B95-8 [39] и клеток Namalwa [40] с использованием аналогичных методов. Концентрацию ДНК в образцах определяли УФ-спектрофотометрией. Число копий генома EBV в образцах ДНК определяли с помощью ПЦР в реальном времени. Вкратце, 5 мкл ДНК (1–5 нг / мкл) были включены в 25 мкл реакции с использованием протокола производителя (набор Qiagen Quantitect Virus). После 10-минутного шага при 95 ° C для активации полимеразы выполняли цикл (40 циклов). Цикл (40 повторов) (15 с при 95 ° C, затем 60 с при 60 ° C со сбором данных либо на источнике 470 нм, при обнаружении 510 нм для FAM (зонд EBV BALF5) или на источнике 530 нм, обнаружении на 555 нм для JOE (Датчик B2M).Праймеры и зонды описаны в таблице 1. Число геномов EBV в тестируемых образцах определяли количественно относительно ДНК B95-8 и Namalwa, а количество копий EBV на клетку в тестируемых образцах выражали относительно гена микроглобулина β-2 [41 ]. Нижний предел обнаружения составлял четыре копии EBV в 5 мкл образца ДНК (= 50 мкл исходного объема крови).

10.1371 / journal.pone.0014013.t001 Таблица 1

Праймеры, используемые для количественной оценки EBV с помощью ПЦР в реальном времени.
Имя Функция Последовательность (от 5 ‘до 3’)
мес 052 EBV BALF5 передний праймер CCTTTGGCGCGGATCCTC
мес 053 EBV BALF5 обратная грунтовка TCCTTCTTGGCTAGTCTGTTGAC
мес 054 Зонд EBV BALF5 5 ′ 6-FAM, 3 ′ TAMRA CATCAAGAAGCTGCTGGCGGCC
мес 055 Праймер В2М GGGAATTGATTTGGGAGAGCATC
мес 056 Праймер обратный B2M AGGTCCTGGCTCTACAATTTACTAA
мес 057 Датчик B2M 5 ′ HEX, 3 ′ TAMRA AGTGTGACTGGGCAGATCATCCACCTTC

Статистический анализ

Связь инфицирования ЦМВ и ВЭБ количественно определялась с использованием критерия хи-квадрат Пирсона.Различия в логарифме 10 трансформированного ответа вакцины между статусом инфекции CMV и EBV (и их взаимодействием) тестировали с использованием линейной регрессии с поправкой на возможный смешивающий эффект малярийной инфекции. Из-за высокой доли нулевых ответов IgM на менингококк C ответы были дихотомизированы около 0,10 мкг / мл и проанализированы с использованием логистической регрессии.

Титры HAI были разделены на 8 групп, и была использована порядковая логистическая регрессия для изучения связи со статусом инфекций EBV и CMV, что позволило выявить возможный смешивающий эффект антител против кори до вакцинации.

Поскольку ELISA по менингококкам генерировал непрерывные данные, их сравнивали с вирусной нагрузкой EBV с помощью ANCOVA, используя серостатус CMV в качестве фиксированного фактора. Если серостатус ЦМВ был незначительным, вирусную нагрузку ВЭБ сравнивали с уровнем антител с помощью коэффициента корреляции Спирмена, и четыре полученных значения корректировали на множественность с помощью понижающего метода Бонферрони.

Линейная регрессия использовалась для проверки связи между вирусной нагрузкой EBV и антителами к менингококкам IgG и IgM с поправкой на серостатус CMV.

Анализы были выполнены с использованием Stata 11 (Statacorp) и Matlab 7.4 (The MathWorks Inc). Различия считались достоверными при p <0,05.

Результаты

Анализы были ограничены 178 субъектами, которым была сделана кровь и вакцинированы в возрасте 9 месяцев и у которых были данные по антителам в возрасте 11 месяцев.

ЦМВ было инфицировано больше младенцев, чем ВЭБ.

ЦМВ-инфекция обычно была раньше, чем ВЭБ (рис. 1). Через девять месяцев 115 из 173 (66%) классифицируемых субъектов были инфицированы ЦМВ по сравнению с 30 из 166 субъектов, инфицированных ВЭБ.10% неинфицированных ЦМВ субъектов и 8% неинфицированных ВЭБ субъектов были инфицированы в возрасте от 9 до 11 месяцев. Не было обнаружено значимых ассоциаций между серопозитивностью на ЦМВ и ВЭБ.

Мало кто из младенцев заразился малярией или корью

Через девять месяцев 30 из 176 (17%) исследованных образцов оказались серопозитивными на малярию. Серопозитивность на малярию не была связана с серопозитивностью на ЦМВ или ВЭБ.

Серопозитивность на корь до вакцинации была редкостью, только шесть из 178 (3.4%) младенцев, протестированных непосредственно перед вакцинацией, у которых обнаруживается уровень активности гемагглютинирующих антител.

Инфекция ВЭБ была связана с низкими реакциями антител на полисахарид менингококка

. Не было значительных статистических взаимодействий между эффектами ВЭБ и ЦМВ на какой-либо из измеренных ответов на менингококк.

Уровни IgG и IgM к менингококкам A и C через 11 месяцев сравнивали с помощью серостатуса EBV на момент введения вакцины через девять месяцев.Ответы IgG были значительно ниже у младенцев EBV + (p <0,05). Однако не было обнаружено различий между младенцами EBV + и EBV в уровнях антител к менингококку A или C IgM (таблица 2). Когда уровни IgG и IgM к менингококкам A и C сравнивались по серостатусу EBV во время отбора проб через одиннадцать месяцев, концентрации как IgG, так и IgM были ниже у младенцев EBV + (p <0,01) (таблица 3).

10.1371 / journal.pone.0014013.t002 Таблица 2

Ответы антител на менингококк A и C, сгруппированные по серостатусу EBV / CMV через девять месяцев.
Штамм Meningococcus Изотип антитела Группа n Медиана (мкг мл −1 ) IQR П *
A IgG EBV 136 2,05 1,30–3,92 0,03
А IgG EBV + 30 1.40 0,80–2,31
А IgM EBV 136 1,29 0,68–2,33 0,10
А IgM EBV + 30 0,97 0,35–1,74
С IgG EBV 136 3,20 1,59–6,80 0.04
С IgG EBV + 30 2,47 1,21–3,86
С IgM EBV 136 0,10 0,01–0,19 0,08
С IgM EBV + 30 0,08 0,02–0,12
А IgG ЦМВ 58 2.00 1,40–4,41 0,12
А IgG CMV + 115 1,75 1,16–3,56
А IgM ЦМВ 58 1,30 0,69–2,36 0,55
А IgM CMV + 115 1,13 0,58–2,27
С IgG ЦМВ 58 3.67 1,77–6,63 0,28
С IgG CMV + 115 2,68 1,35–5,63
С IgM ЦМВ 58 0,09 0,01–0,19 0,83
С IgM CMV + 115 0,09 0,02–0,17

* Рассчитано с помощью модели линейной регрессии.Значимые значения выделены жирным шрифтом.

Инфекция EBV во время введения вакцины через девять месяцев предсказывает снижение ответа антител как на менингококк, так и на менингококк, но инфекция CMV не имеет никакого эффекта. Группы относятся к серологическому статусу CMV и EBV на момент введения вакцины в девять месяцев.

Инфекция CMV ни во время вакцинации, ни во время отбора проб не была связана с уровнями антител против менингококка через 11 месяцев (Таблица 2, Таблица 3), и ни один из ответов не коррелировал с виремией EBV в возрасте 11 месяцев ( данные не показаны).

10.1371 / journal.pone.0014013.t003 Таблица 3

Ответы антител на менингококк A и C, сгруппированные по серостатусу EBV / CMV через одиннадцать месяцев.
Штамм Meningococcus Изотип антитела Группа n Медиана (мкг мл −1 ) IQR П *
A IgG EBV 124 2.15 1,35–4,13 0,003
А IgG EBV + 41 1,43 0,90–2,31
А IgM EBV 124 1,38 0,71–2,44 0,002
А IgM EBV + 41 0,92 0,32–1,30
С IgG EBV 124 3.44 1,75–7,44 0,006
С IgG EBV + 41 2,41 1,19–3,80
С IgM EBV 124 0,11 0,02–0,19 0,01
С IgM EBV + 41 0,07 0,00–0,12
А IgG ЦМВ 51 2.03 1,31–4,44 0,08
А IgG CMV + 121 1,86 1,20–3,56
А IgM ЦМВ 51 1,35 0,67–2,46 0,39
А IgM CMV + 121 1,13 0,61–2,25
С IgG ЦМВ 51 3.61 1,95–6,19 0,26
С IgG CMV + 121 2,70 1,37–6,18
С IgM ЦМВ 51 0,09 0,01–0,19 0,86
С IgM CMV + 121 0,09 0,02–0,17

* Рассчитано с помощью модели линейной регрессии.Значимые значения выделены жирным шрифтом.

Инфекция EBV через одиннадцать месяцев предсказывает снижение ответа антител как на менингококк, так и на менингококк, но инфекция CMV не имеет никакого эффекта. Группы относятся к серологическому статусу ВЭБ и ЦМВ на момент отбора проб через 11 месяцев.

После начального анализа мы провели несколько тестов на надежность нашего аналитического подхода.

У большинства субъектов, которых нельзя было классифицировать, определяемые уровни IgG к ЦМВ или ВЭБ были ниже, чем в пуповинной крови.Чтобы проверить, могли ли результаты быть искажены из-за невозможности классифицировать младенцев, которые действительно не были инфицированы, мы повторили регрессионный анализ со всеми неклассифицированными младенцами как неинфицированными и обнаружили, что связи все еще остаются значимыми (данные не показаны).

Одиннадцать младенцев получили сероконверсию на ВЭБ в возрасте от 9 до 11 месяцев, и шесть детей получили сероконверсию на ЦМВ, хотя ни у одного из них не произошла сероконверсия для обоих. Чтобы установить, была ли разница между ВЭБ-инфицированными и неинфицированными младенцами результатом воздействия инфекции между временем вакцинации и взятием проб повторили регрессионный анализ, исключив всех младенцев, у которых произошла сероконверсия между двумя периодами отбора проб.Значимые ассоциации остались такими же, как и в исходном анализе (данные не показаны).

Чтобы проверить, влияет ли инфекция малярии на уровни антител против менингококка, мы повторили регрессионный анализ с серопозитивностью к P. falciparum, определяемой как обнаруживаемый ответ на любой из трех протестированных антигенов в качестве фактора. Мы не обнаружили влияния на ассоциации (данные не показаны).

Инфекция ВЭБ предсказывала низкий ответ антител на корь, если не было одновременной инфекции ЦМВ.

Существовали значительные взаимодействия между эффектами инфекции ВЭБ и ЦМВ на реакцию антител против кори, поэтому было неуместно проводить множественные сравнения в четырех возможных группах.

Те же тенденции были очевидны независимо от того, были ли младенцы классифицированы по серостатусу CMV и EBV во время вакцинации в девять месяцев или во время измерения антител в одиннадцать месяцев. В обоих случаях уровни антител у младенцев EBV + CMV были значительно ниже, чем у детей любой из трех других групп, тогда как различия между тремя другими группами были небольшими (рис. 2).

10.1371 / journal.pone.0014013.g002 Рисунок 2

Инфекция EBV, но не CMV, подавляет реакцию антител на корь.

Инфекция ВЭБ связана со снижением ответа антител на корь, если только младенцы не инфицированы ЦМВ. Графики активности сывороточного гемагглютинина в одиннадцатимесячном возрасте, построенные против серологического статуса в момент А во время вакцинации в девятимесячном возрасте и В во время отбора проб в одиннадцатимесячном возрасте. Титры выражены как log 2 . Серые полосы обозначают медианы. Значимость относится к статистическому взаимодействию между эффектами ВЭБ и ЦМВ-инфекции.

Группа EBV + CMV составляла только 8 из 161 (5.0%) классифицируемых младенцев в девять месяцев и 13 из 159 (8,2%) в одиннадцать месяцев. Медиана log (основание 2) HAI-титр у младенцев EBV + CMV составляла 2,5 по сравнению с 4,0 среди младенцев EBV CMV , классифицированных по серостатусу в девять месяцев. Разница, основанная на серологическом статусе через одиннадцать месяцев, была меньше, но средний ингибирующий титр составлял 3,0 среди младенцев EBV + CMV по сравнению с 4,0 среди младенцев EBV CMV .

Инфекция

CMV сама по себе не оказала большого влияния на титр антител, но, по-видимому, компенсировала сниженный ответ антител, связанный с EBV, поскольку средний титр среди младенцев EBV + CMV + составлял 5,0 как в девять, так и в одиннадцать месяцев (рис. 2).

Включение титра антител против кори до вакцинации в регрессионную модель не повлияло на ассоциации между ЦМВ и ВЭБ с антителами против кори или взаимодействие между ЦМВ и ВЭБ, а также на присутствие и титр антител против кори до вакцинации антитела были связаны с антителами против кори в любой из групп через 11 месяцев.

Обсуждение

Мы обнаружили, что инфекция ВЭБ до или вскоре после вакцинации в возрасте 9 месяцев предсказывала более низкий ответ антител как на Т-клеточно-зависимые антигены кори, так и на Т-клеточно-независимые полисахаридные антигены менингококка, но эта коинфекция с ЦМВ была связана с ответами, эквивалентными таковым у неинфицированных младенцев.

Мы можем только предполагать иммунные механизмы, лежащие в основе этих взаимодействий, поскольку исследование было сосредоточено на измерениях антител. Однако описано несколько механизмов взаимодействия между вирусными инфекциями.Например, один вирус может вызывать иммунный ответ, который подавляет рост другого [42], [43], или специфические иммунные ответы, вызванные одним вирусом, могут перекрестно реагировать с эпитопами, экспрессируемыми другим [44].

Более низкий ответ антител у младенцев, инфицированных EBV, согласуется с выводом о том, что EBV-инфекция B-клеток вызывает мутации, которые могут препятствовать продукции антител [18]. Работа на мышиных моделях показала, что иммунная система может поддерживать только конечное число клеток, продуцирующих антитела [45], поэтому также возможно, что экспансия, вызванная EBV, сокращает доступные ниши для клеток, продуцирующих вакцино-специфические антитела.

Коинфекция CMV, по-видимому, возвращала уровни антител к Т-клеточно-зависимому геммаглютинину до уровней, обнаруженных у младенцев EBV . Поскольку ЦМВ-инфекция не влияла на антитела к Т-клеточно-независимой менингококковой вакцине, это предполагает, что восстановление опосредовано Т-клетками. В Гамбии мы ранее обнаружили, что инфекция ЦМВ способствует дифференцировке Т-лимфоцитов CD4 у младенцев и что клеточные ответы на ЦМВ коррелируют с ответом антител на вакцину против кори [26], что позволяет предположить, что воздействие ЦМВ может увеличивать выработку антител через специфическая повышающая регуляция опосредованной CD4 Т-клетками помощи.Исследования в Гамбии [26] и Малави [46] показали, что инфекция ЦМВ связана с относительно высокой долей клеток памяти как в компартментах Т-клеток CD4, так и CD8, что согласуется с нашими выводами. Эти предполагаемые взаимодействия ЦМВ с вакцинами необходимо изучить в более широком масштабе в раннем младенчестве, когда заболеваемость ЦМВ наиболее высока, а вакцинация наиболее интенсивна.

Нам не удалось отличить эффекты заражения EBV и CMV во время вакцинации от эффектов во время отбора проб, поэтому мы не смогли установить, запрограммированы ли низкие уровни вакцинных антител у EBV-инфицированных младенцев во время инфекции или инфицирование после вакцинация может снизить текущее производство антител.В любом случае примерно 20% младенцев были инфицированы EBV в возрасте девяти месяцев и, следовательно, имели более низкий иммунный ответ, что является значительным числом, даже если инфицирование EBV после вакцинации не оказывает такого же подавляющего действия.

Маловероятно, что одна только инфекция EBV является достаточным объяснением снижения эффективности противокоревой вакцины в Африке, поскольку только 10% младенцев были EBV + CMV . Однако величина снижения ответа антител предполагает, что ВЭБ может быть фактором, способствующим иммунизации в раннем возрасте, сохранением материнских антител [47] и интенсивным воздействием во время вспышек кори из-за перенаселенности [48].

Малярия связана с иммуносупрессией ответа на вирусную инфекцию [17], [49] и вакцины против менингококкового полисахарида и Haemophilus influenzae [2], [3]. Однако отсутствие связи между низким уровнем воздействия малярии и инфекцией ЦМВ или ВЭБ в этой когорте или между воздействием малярии и ответом антител на вакцины делает маловероятным, что инфекция малярии нарушила связь между уровнями антител и инфекцией ЦМВ и ВЭБ в этой когорте. Вместе с низкой распространенностью ВИЧ и отсутствием одновременных вспышек заболеваний маловероятно, что за наблюдаемыми различиями стояла другая инфекция.Из-за нехватки сывороток мы не смогли измерить концентрацию менингококковых антител до вакцинации. Однако предыдущие исследования в этом регионе показали, что материнские антитела быстро распадаются и что у младенцев неопределяемые или очень низкие уровни [50] и очень низкие показатели носительства [51], поэтому перенесенная или интеркуррентная инфекция менингококками вряд ли повлияла на наши результаты.

Наше исследовательское исследование было относительно ограниченным по размеру и не могло дать механистического объяснения потенциально важных результатов.Потребуются более масштабные исследования, чтобы установить, влияет ли инфекция ЦМВ или ВЭБ на эффективность вакцины или увеличивает восприимчивость к инвазии инкапсулированными полисахаридами бактериями, такими как Streptococcus pneumoniae или Neisseria meningitidis, которые распространены в этом регионе. Более того, понимание взаимодействия этих распространенных инфекций раннего возраста с иммунной системой младенца может пролить свет на неспецифические эффекты вакцин, о которых сообщалось в Западной Африке [52], [53].

Выводы

Инфекция EBV снижает антительный ответ на Т-клеточно-независимые полисахаридные вакцины, в то время как инфекция CMV не оказывает никакого эффекта.Инфекция только EBV снижала антительный ответ на живую противокоревую вакцину, но коинфекция CMV обращала вспять эффекты EBV и повышала антительный ответ до уровней, аналогичных таковым у младенцев, инфицированных ни одним из вирусов.

туго прошивается? SsangYong Kyron. Российская сборка Что подтверждает производство Chiron в Корее

SsangYong Motor Company — южнокорейский производитель легковых автомобилей со штаб-квартирой в Сеуле. Sang Yong в переводе с русского означает «два дракона», компания занимает третье место среди корейских автопроизводителей по количеству проданных автомобилей.

Официальной датой основания в истории компании SsangYong считается октябрь 1954 года, на момент своего появления компания получила название Hadonghwan Motor Company. Первой продукцией автопроизводителя стали лицензионные Willys (армейские внедорожники), поставляемые в южнокорейскую армию. Благодаря постоянным заказам военных компания Sanyeng (есть еще транскрипции Sang Yong, Sangeng или Ssangyong) быстро достигла финансового успеха и постепенно расширила ассортимент выпускаемой техники.В 60-70-е годы предприятию удалось наладить выпуск грузовых автомобилей, автобусов и спецтехники.

В 1967 году в рамках партнерства с Shinjin jeep Motor Co., Ltd. заключены контракты на поставку автобусов во Вьетнам.

1974, Hadonghwan Motor Company становится совладельцем джипа Motor Shinjin.
В 1976 году компания меняет название на Dong-A Motor. Ведется разработка новых внедорожников, рассчитанных на перевозку 4-6 человек с использованием дизельных двигателей.
В 1979 году открытие нового завода по сборке автомобилей в городе Пхёнтек.
1983 г. Покупка торговой марки Korando у Geohwa Co., Ltd с последующим поглощением компании Geohwa.

В 1986 году Dong-A Motor перешла под контроль Ssangyong Business Group, а в 1988 году получила свое нынешнее название SsangYong Motor. В модельном ряду появляется семейство Korando, созданное на платформе японского Isuzu Trooper.
В 1991 году предприятия SsangYong заключили договор о техническом сотрудничестве с Mercedes-Benz AG (разработка новых бензиновых двигателей).
В 1993 году Mercedes-Benz AG стала одним из основных акционеров Ssang Yong Motors, вторым совладельцем является китайская компания SAIC Motor.Mercedes AG и Sanyeng Motors присоединяются к техническому союзу. На данном этапе истории Sang Yong все автомобили производятся под контролем представителей Mercedes-Benz.

В

машинах SsangYong используются двигатели, коробки передач и многие конструкторские решения и технологии немецкого автомобильного гиганта. Запуск внедорожника SsangYong Musso.

В 1995 году в Европе начались продажи корейских автомобилей Sang Yong, первенцем стала модель Istana — точная копия микроавтобуса Mercedes-Benz MB 100, выпускавшегося с 1988 по 1995 год.
В 1996 году появляется новый Korando, компания сертифицирует свою продукцию по международным стандартам ISO.
В 1997 году в модельном ряду Sanyeng появляется представительский седан Chair на базе Mercedes-Benz W124.
В 1998 году компания перешла под контроль Daewoo Group, но ненадолго. Два года спустя, в 2000 году, Ssang Yong снова стала независимой структурой.
В 2001 году стартует производство внедорожной новинки Rexton.

В 2002 году пикап SsangYong Musso Sports запущен в серийное производство.
В 2003 году было представлено новое поколение седана Chair и минивэна Rodius с противоречивым дизайном.
В 2005 году дебютирует внедорожник SsangYong Kyron.
В 2006 году вышла очередная новинка от Sang Yong Actyon.

В 2008 году состоится премьера первого кроссовера в модельном ряду SsangYong — C200 Concept (всего через два года, после смены названия на Korando, автомобиль дойдет до покупателей). В том же году руководство компании объявляет о банкротстве, после реструктуризации предприятие выставлено на продажу.12 августа 2012 года SsangYong Motor был приобретен индийским концерном Mahindra & Mahindra Limited.
Производство внедорожников Sanyeng для российских покупателей осуществляется на заводах Sollers в Набережных Челнах и Владивостоке.

Сегодня в России и странах СНГ автомобили Ssang Yong пользуются устойчивым спросом. В автосалонах России представлены модели корейско-индийского производителя: Actyon, Kyron, Rexton и пикап Actyon Sport. Украинским покупателям доступны
Korando (близнец российского Actyon), Actyon и Actyon Sports, New Actyon Sports, New Kyron и Rexton II.Возможно, в ближайшем будущем к корейским внедорожникам, продаваемым на постсоветском пространстве, добавятся представительские седаны SsangYong.

SsangYong Kyron — южнокорейский кроссовер. Автомобиль выпускается с 2005 года. Изначально для российского рынка Chiron собирался в Набережных Челнах, а с декабря 2009 года — во Владивостоке (это была первая модель нового предприятия «Соллерс — Дальний Восток»).

Не случайно Kyron получил свои «внедорожные корни», ведь работа с внедорожниками, можно сказать, в крови SsangYong.Еще во время войны между Северной и Южной Кореей появилась компания Donghwan Motor, которая занималась производством военных вездеходов. Спустя пару лет компания сменила название на SsangYong и продолжила заниматься автомобильной промышленностью, но на этот раз гражданской. Постепенно она начала скупать другие корейские компании, создав автомобильную монополию. Первым гражданским внедорожником концерна SsangYong стал Korando Family, имевший. Эта деталь была впоследствии принята Кайроном.

Частично предшественник Kyron, разработанный Кеном Гринли (который также разработал Kyron). Кроме того, на Musso впервые был установлен лицензионный двигатель Mercedes-Benz, который позже перекочевал на Kyron. Однако Musso — полноценный внедорожник, а Chiron создавался в первую очередь как городской кроссовер. Платформа для него, которая выпускается с 2001 года (сам Rexton построен на базе Mercedes-Benz M-класса).

Через год после дебюта Кайрона в продажу поступил SsangYong Actyon.Эти две машины являются одноклассниками и отличаются только кузовом и дизайном интерьера. SsangYong Actyon выпускался с 2006 по 2011 год, но его производство было закрыто из-за повышенного спроса на Chiron. Однако Кайрону не суждено было остаться одному. В том же 2011 году на мощностях дальневосточного завода «Соллерс» возобновлено производство брата Кайрона по классу — обновленного SsangYong New Actyon.

Технические характеристики

Кузов автомобиля имеет рамную конструкцию, что дает множество преимуществ.Рама изготовлена ​​из высокопрочного металла, добавляет автомобилю веса, тем самым устраняя вибрации внутри кабины во время движения. Кроме того, в случае столкновения кузов серьезно защищен от деформации.

Еще одним плюсом внедорожных характеристик автомобиля является конструкция крыльев. Инженеры SsangYong сумели спроектировать их таким образом, чтобы даже при движении по грязи очки Kyron были надежно защищены и оставались чистыми.

На российском рынке 2.Для кроссовера предлагается 3-литровый бензиновый мотор, а также 2,0-литровый турбодизель — особая гордость «корейца», доставшаяся в наследство от Mercedes. На других рынках дизельный Kyron также встречается в версии 2,7 литра.

Кен Гринли, дизайнер Кайрона, признался, что при создании первой версии автомобиля он слишком увлекся культурой средневековья. В результате интерьер получил много округлости в конструкции приборов, а рукоятка «ручника» в целом имела вид рукояти меча.Столь нестандартная внешность Кайрон показалась маркетологам компании слишком провокационной, и ее «успокоили» рестайлингом.

Изначально Chiron собирался на заводе в Набережных Челнах, где тогда же производилась машина «Ока».

Ни в какой, даже самой богатой конфигурации Kyron нет штатной магнитолы. Его установкой придется решать дилерам или владельцу самостоятельно.

Достоинства и недостатки

Фактически ближайшим соперником корейского кроссовера можно считать Suzuki Grand Vitara.При аналогичных габаритах Chiron может похвастаться более просторным салоном и возможностью регулировки руля по вылету (отсутствие этой регулировки на Grand Vitara — парадокс, не имеющий объяснения).

Еще один плюс в копилку Кайрона — большой объем багажника, который можно увеличить, сложив задние сиденья (до 1085 литров).

Из минусов можно выделить отсутствие на Chiron режима помощи при спуске с горы, что характерно для любого современного внедорожника.

Наконец, совершенно неожиданный недостаток — стоимость обслуживания автомобиля в России. Несмотря на корейское происхождение, цены у официальных дилеров совсем не «корейские».

В целом SsangYong Kyron и Suzuki Grand Vitara — это автомобили разной специфики. Chiron предлагает владельцу уверенную тягу на низких оборотах (в дизельной версии), комфорт и надежность даже на бездорожье. В свою очередь, Vitara более шустрая машина, она трясет и чувствуется прохождение каждой неровности, что добавляет драйва во время загородной поездки.

Целевая аудитория

SsangYong Kyron
— выбор любителей комфортных путешествий по городу и регулярных пикников на природе. В меру мощный, надежный и вместительный, он отлично подойдет для небольшой семьи. Кроме того, не забывайте, что Kyron — флагман линейки SsangYong по очень разумной цене.

Награды и цифры

В 2006 году британский журнал 4×4 включил SsangYong Kyron в список лучших внедорожников года.Автомобиль занял 6-ю позицию с результатом 29 баллов (для сравнения, победитель Jeep Commander — 39).

В 2007 году Хирон был включен в список претендентов на звание «Автомобиль года» в Европе, но не дошел до финала, а тем более до победы.

25 марта 2010 года завод «Соллерс — Дальний Восток» торжественно отметил тысячный Кайрон, сошедший с конвейера. Всего в 2010 году в России было продано 1548 автомобилей SsangYong Kyron.

Внедорожник SsangYong Kyron был запущен в Корее в 2005 году.Автомобиль выделялся оригинальным внешним видом, автором которого выступил британский дизайнер Кеннет Гринли.

Автомобиль имел рамную конструкцию, Chiron для корейского рынка имел независимую заднюю подвеску и семиместный седан, а экспортные версии имели неразрезную заднюю ось и пять мест в салоне. Привод полный, с жестко подключаемыми передком и понижающей передачей, а в Корее предлагались и заднеприводные модификации.

На SsangYong Kyron устанавливались лицензионные силовые агрегаты марки «Мерседес»: четырехцилиндровый турбодизель объемом 2 штуки.0 литров и пятицилиндровый объемом 2,7 литра (на российский рынок такие машины не поставлялись). Коробки передач — пятиступенчатая, механическая или автоматическая.

В 2007 году модель подверглась рестайлингу: «Sanyeng Kyron» получил более гармоничный дизайн, немного измененный интерьер и бензиновый двигатель объемом 2,3 литра мощностью 150 л.с. из. в сочетании с «механикой» или четырехступенчатым «автоматом». В 2009 году на некоторые версии модели начали устанавливать новую шестиступенчатую автоматическую коробку передач.

Хироны для российского рынка собираются с 2006 года на заводе Sollers в Набережных Челнах, а в конце 2009 года производство перенесено во Владивосток. Цены на внедорожник начинались с 800 тысяч рублей (в 2010 году).

В Корее производство SsangYong Kyron было прекращено в 2011 году, а сборка автомобилей во Владивостоке продолжалась до 2014 года (по окончании срока службы конвейера небольшая партия одноприводных автомобилей вышла на российский рынок). Лицензионная копия модели была произведена в Китае под названием.

Sanyeng Kyron таблица двигателя автомобиля

Мне удалось побывать в сборочном цехе завода «Соллерс — Дальний Восток». Поехал, посмотрел, сфотографировал как собираются машины. Основной целью визита стал SsangYong New Actyon, автомобиль, запущенный в серийное производство на Приморском заводе.

Здесь собралось много людей, иностранных гостей, прессы, руководство завода и многие другие.
Чтобы никого не потерять, всех распределили по группам и назначили личного гида.
1.

Фотография была моей целью, поэтому я немедленно отбился от своей группы. Гид много рассказывал о каждом этапе сборки, отвечал на любые вопросы, жалею, что покинул группу, т.к. подписи к фотографиям нигде не найти%)

Новая линия:
2.

Кузов без наполнения
3.

ждет на линии
4.

Такие минитракторы доставляют всевозможные запчасти по всему заводу.
5.

Среди сотрудников было много девушек
6.

Надпись на табличках характеризует рабочий процесс
7.

видимо они занимаются подсборкой моторного отсека
8.

Колеса готовы занять их место
9.

Собсно установка
10.

11.

За что отвечает этот компьютер, не разобрался
12.

Крутят что-то там
13.

Новый конвейер
14.

Сотни метров проводов и широкий выбор электрических аксессуаров
15.

Этот парень ведет лифт
16.

А этот ставит двигатель в машину
17.

18.

19.

20.

21.

Человеческий труд
22.

С помощью подъемника рабочие устанавливают кузов
23.

и исправить
24.

Иностранные гости внимательно изучают процесс сборки
25.

26.

Собранные автомобили выстроены в очень светлый цех, мощные лампы дают возможность увидеть, нет ли на краске царапин, сколов или других косяков
27.

Последний этап. Авто готовится к компьютерной диагностике. Коробка
28.

Диагностика
29.

Вагоны с полной отделкой
30.

Ну вот и все, что видел в продакшене.

В конце экскурсии все наконец-то собрались плотным кольцом вокруг новой машины, покрытой белым брезентом. С докладом выступил Александр Владимирович Корнейчук, генеральный директор ООО «СОЛЛЕРС-Дальний Восток».
31.

По окончании торжественного представления гостям было представлено световое шоу. Лучи раскрасили машину в разные цвета, нарисовали на ней всевозможные изображения, красиво ..
32.

После этого машину дали на разборку всем желающим.
33.

NEW Actyon — первый кроссовер SsangYong с несущим кузовом и системой полного привода
34.

Это уже пятая модель, производство которой налажено на заводе во Владивостоке наряду с Rexton, Kyron, Actyon, Actyon Sports.
35.

Продажи новой модели Actyon начнутся в феврале, первые автомобили появятся у дилеров на Дальнем Востоке.
36.

В России NEW Actyon будет доступен с двумя версиями дизельного двигателя мощностью 175 л.с.и 149 л. Кроме того, NEW Actyon оснащается 6-ступенчатой ​​механической или 6-ступенчатой ​​автоматической коробкой передач с функцией ручного переключения.

Цены на базовую версию SsangYong NEW Actyon начинаются от 799 тысяч рублей с двигателем 149 л.с., МКПП и передним приводом.

Самая популярная, как и ожидалось, модификация с двигателем 149 л.с., АКПП и полным приводом доступна от 939 тысяч рублей.

ОАО «Северсталь-авто», официальный импортер и производитель SsangYong в России, объявляет о начале производства нового среднеразмерного внедорожника SsangYong Kyron.Автомобиль появится в салонах официальных дилеров в конце августа 2007 года.

Благодаря новым дизайнерским решениям передней и задней части кузова Kyron практически полностью изменил свой имидж. Обновленная геометрия кузова, полностью переработанные фары и задние фонари, изысканная фальш-решетка радиатора, новые бамперы, а также другие изменения экстерьера сделали новый SsangYong Kyron более элегантным и придали автомобилю индивидуальный городской шик.

Первоначально новый Kyron будет поставляться в дилерские центры с 2.Бензиновый двигатель объемом 3 литра (150 л.с., выпускается по лицензии Mercedes-Benz), который может агрегатироваться с 5-ступенчатой ​​механической или 4-ступенчатой ​​автоматической коробкой передач. Трансмиссия внедорожника оснащена неполной системой полного привода, которая имеет повышающий и понижающий диапазоны передач.

Оснащен современными системами активной безопасности: антиблокировочная тормозная система — ABC, система стабилизации и курсовой устойчивости — ESP (включая систему предотвращения опрокидывания — ARP и вспомогательную тормозную систему — BAS), ассистент движения на спуске — HDC, в сочетании с супер- Жесткая стальная рама, фронтальные и боковые подушки безопасности, точное рулевое управление — новый Kyron является самым безопасным среди среднеразмерных внедорожников.

Более того, проверенная подвеска с независимой передней подвеской на двойных поперечных рычагах и многорычажной задней осью обеспечивает новому SsangYong Kyron надежную управляемость на всех типах дорожных покрытий. Это соотношение представляет собой лучший компромисс между внедорожными качествами, точной управляемостью и высокой надежностью автомобиля.

Серьезных изменений в интерьере не так много — их можно сравнить с легкими мазками мастера, придающими законченный вид работе ученика. С помощью незначительных доработок дизайнеры автомобилей создали внутри внедорожника уютную и респектабельную атмосферу, сохранив при этом выверенную эргономику интерьера.Так, изменился цвет подсветки панели приборов и экрана системы климат-контроля — зеленый цвет сменился более приятным янтарным. Обновлен общий тон отделки салона, нейтральный серый цвет заменен на более строгий черный. Небольшие изменения были внесены в дизайн центральной консоли.

Обладая богатой комплектацией и отличными техническими характеристиками, стоимость базовой версии новинки составляет 802 тысячи рублей, а в максимальной комплектации — 2.Модель 3 с АКПП обойдется в 977 тысяч рублей. Ожидается, что новый внедорожник с привлекательным дизайном, отличным соотношением цены и качества, вместительностью и универсальностью станет бестселлером SsangYong в России. К концу 2007 года его продажей и сервисной поддержкой будут заниматься более 80 официальных дилеров.

249 ser TP53 мутация в ДНК плазмы, вирусная инфекция гепатита B и риск гепатоцеллюлярной карциномы

  • Aguilar F, Harris CC, Sun T, Hollstein M и Cerutti P.(1994). Science , 264 , 1317–1319.

  • Анкер П., Малкахи Х. и Строун М. (2003). Внутр. J. Cancer , 103 , 149–152.

  • Autrup H, Seremet T., Wakhisi J и Wasunna A. (1987). Cancer Res. , 47, , 3430–3433.

  • Bah E, Parkin DM, Hall AJ, Jack AD и Whittle H. (2001). Br. J. Cancer , 84 , 1207–1214.

  • Bannasch P, Khoshkhou NI, Hacker HJ, Radaeva S, Mrozek M, Zillmann U, Kopp-Schneider A, Haberkorn U, Elgas M и Tolle T.(1995). Cancer Res. , 55 , 3318–3330.

  • Brechot C, Gozuacik D, Murakami Y и Paterlini-Brechot P. (2000). Семин. Cancer Biol. , 10 , 211–231.

  • Bressac B, Kew M, Wands J и Ozturk M. (1991). Nature , 350 , 429–431.

  • Chen CJ, Wang LY, Lu SN, Wu MH, You SL, Zhang YJ, Wang LW и Santella RM. (1996). Гепатология , 24 , 38–42.

  • Coursaget P, Depril N, Chabaud M, Nandi R, Mayelo V, LeCann P и Yvonnet B. (1993). Br. J. Cancer , 67 , 1395–1397.

  • Фридлер А., Вепринцев Д.Б., Ханссон Л.О. и Фершт А.Р. (2003). J. Biol. Chem. , 278 , 24108–24112.

  • Ghebranious N и Sell S. (1998). Гепатология , 27 , 967–973.

  • Групман Дж. Д., Шолль П. и Ван Дж. С.. (1996). Прог. Clin. Биол. Res. , 395 , 211–222.

  • Hagen TM, Huang S, Curnutte J, Fowler P, Martinez V, Wehr CM, Ames BN и Chisari FV. (1994). Proc. Natl. Акад. Sci. США , 91 , 12808–12812.

  • Эно П. и Холлштейн М. (2000). Adv. Cancer Res. , 77 , 81–137.

  • Hudson GJ, Wild CP, Zarba A и Groopman JD. (1992). Нат. Токсины , , 1 , 100–105.

  • Хуссейн С.П. и Харрис К.С. (2000). Mutat Res. , 462 , 311–322.

  • МАИР (1994). Монографии по оценке канцерогенных рисков для человека, Vol. 59 . Международное агентство по изучению рака: Лион, Франция.

  • МАИР (2002). Монографии по оценке канцерогенных рисков для человека, Vol. 82 . Международное агентство по изучению рака: Лион, Франция.

  • Jackson PE и Groopman JD.(1999). Baillieres Best Pract. Res. Clin. Гастроэнтерол. , 13 , 545–555.

  • Jackson PE, Kuang SY, Wang JB, Strickland PT, Munoz A, Kensler TW, Qian GS и Groopman JD. (2003). Канцерогенез , 24 , 1657–1663.

  • Jackson PE, Qian GS, Friesen MD, Zhu YR, Lu P, Wang JB, Wu Y, Kensler TW, Vogelstein B. и Groopman JD. (2001). Cancer Res. , 61 , 33–35.

  • Кирк Г.Д., Камю-Рандон А.М., Менди М., Гёдерт Дж. Дж., Мерле П., Трепо С., Брехо С., Эно П. и Монтесано Р.(2000). J. Natl. Cancer Inst. , 92 , 148–153.

  • Кирк Г.Д., Лези О.А., Менди М., Акано А.О., Сэм О., Годерт Дж.Дж., Эно П., Холл А.Дж., Уиттл Х. и Монтесано Р. (2004). Гепатология , 39 , 211–219.

  • Лян Т.Дж. и Гани М. (2002). N. Engl. J. Med. , 347 , 208–210.

  • Лин Д.Й., Шин И.С., Чиу Коннектикут, Лин С.М., Куо Ю.К. и Лиав Ю.Ф. (1993). J. Clin. Ультразвук , 21 , 303–308.

  • Лю М.С. и Гельманн Э.П. (2002). Семин. Онкол. , 29 , 246–257.

  • Мандишона Э., Макфейл А.П., Гордюк В.Р., Кедда М.А., Патерсон А.С., Руо Т.А. и Кью М.С. (1998). Гепатология , 27 , 1563–1566.

  • Менди ME, Fortuin M, Hall AJ, Jack AD и Whittle HC. (1999). Br. J. Biomed. Sci. , 56 , 34–38.

  • Менди М.Э., Уиттл Х.С., О’Донован Д. и Кекуле А.С.(1998). Br. J. Biomed. Sci. , 55 , 92–93.

  • Montesano R, Hainaut P и Wild CP. (1997). J. Natl. Cancer Inst. , 89 , 1844–1851.

  • Olubuyide IO, Maxwell SM, Hood H, Neal GE и Hendrickse RG. (1993). Afr. J. Med. Med. Sci. , 22 , 89–91.

  • Омер Р.Э., Баккер М.И., Ван’т Вир П., Хугенбум Р.Л., Полман Т.Х., Алинк Г.М., Идрис М.О., Кадару А.М. и Кок Ф.Дж. (1998). Nutr. Рак , 32 , 174–180.

  • Омер Р. Э., Верхоф Л., Ван’т Вир П., Идрис М. О., Кадару А. М., Кампман Е., Буншотен А. и Кок Ф. Дж.. (2001). Контроль причин рака. , 12 , 23–32.

  • Озтюрк М. (1991). Ланцет , 338 , 1356–1359.

  • Пейн Р.Дж., Новак М.А. и Блумберг Б.С. (1996). Proc. Natl. Акад. Sci. США , 93 , 6542–6546.

  • Пизани П., Паркин Д.М., Муньос Н. и Ферлай Дж.(1997). Cancer Epidemiol. Биомаркеры Пред. , 6 , 387–400.

  • Ponchel F, Puisieux A, Tabone E, Michot JP, Froschl G, Morel AP, Frebourg T, Fontaniere B, Oberhammer F и Ozturk M. (1994). Cancer Res. , 54 , 2064–2068.

  • Цянь Г.С., Росс Р.К., Ю М.К., Юань Дж.М., Гао Ю.Т., Хендерсон Б.Е., Воган Г.Н. и Групман Дж. Д.. (1994). Cancer Epidemiol. Биомаркеры Пред. , 3 , 3–10.

  • Продам П.(1993). Внутр. J. Dev. Биол. , 37 , 189–201.

  • Смела ME, Currier SS, Bailey EA and Essigmann JM. (2001). Канцерогенез , 22 , 535–545.

  • Смела М.Э., Хамм М.Л., Хендерсон П.Т., Харрис К.М., Харрис ТМ и Эссигманн Дж. (2002). Proc. Natl. Акад. Sci. США , 99 , 6655–6660.

  • Stern MC, Umbach DM, Yu MC, London SJ, Zhang ZQ и Taylor JA. (2001). Cancer Epidemiol.Биомаркеры Пред. , 10 , 617–625.

  • Штамм AJ и Crosby HA. (2000). Кишечник , 46 , 743–745.

  • Sun Z, Lu P, Gail MH, Pee D, Zhang Q, Ming L, Wang J, Wu Y, Liu G и Zhu Y. (1999). Гепатология , 30 , 379–383.

  • Szymanska K, Lesi OA, Kirk GD, Sam O, Taniere P, Scoazec JY, Mendy M, Friesen MD, Whittle H, Montesano R и Hainaut P. (2004). Внутр. J. Cancer , 110 , 374–379.

  • Taback B и Hoon DS. (2004). Curr. Opin. Мол. Ther. , 6 , 273–278.

  • Торгейрссон СС. (1995). Принцесса Такамацу Symp. , 25 , 163–170.

  • Торгейрссон СС и Гришэм Дж. У. (2002). Нат. Genet. , 31 , 339–346.

  • Тернер ПК, Менди М., Уиттл Х, Фортуин М., Холл А.Дж. и Уайлд С.П. (2000). Троп. Med. Int. Здравоохранение , 5 , 837–841.

  • Валл Майанс М., Холл А.Дж., Инскип Х.М., Чотард Дж., Линдси С.В., Коромина Е., Менди М., Алонсо П.Л. и Уиттл Х. (1990). Ланцет , 336 , 1107–1109.

  • van Rensburg SJ, van Schalkwyk GC и van Schalkwyk DJ. (1990). J. Environ. Патол. Toxicol. Онкол. , 10 , 11–16.

  • Wang LY, Hatch M, Chen CJ, Levin B, You SL, Lu SN, Wu MH, Wu WP, Wang LW, Wang Q, Huang GT, Yang PM, Lee HS и Santella RM.(1996). Внутр. J. Cancer , 67 , 620–625.

  • Wang XW, Hussain SP, Huo TI, Wu CG, Forgues M, Hofseth LJ, Brechot C и Harris CC. (2002). Токсикология , 181–182 , 43–47.

  • Уиттл Х., Инскип Х., Брэдли А.К., Маклафлан К., Шентон Ф., Лэмб В., Экклс Дж., Бейкер Б.А. и Холл А.Дж.. (1990). J. Infect. Дис. , 161 , 1112–1115.

  • Wild CP, Hasegawa R, Barraud L, Chutimataewin S, Chapot B, Ito N и Montesano R.(1996). Cancer Epidemiol. Биомаркеры Пред. , 5 , 179–189.

  • Wild CP, Hudson GJ, Sabbioni G, Chapot B, Hall AJ, Wogan GN, Whittle H, Montesano R и Groopman JD. (1992). Cancer Epidemiol. Биомаркеры Пред. , 1 , 229–234.

  • Wild CP, Jiang YZ, Allen SJ, Jansen LA, Hall AJ и Montesano R. (1990). Канцерогенез , 11 , 2271–2274.

  • Wild CP, Pionneau FA, Montesano R, Mutiro CF и Chetsanga CJ.(1987). Внутр. J. Cancer , 40 , 328–333.

  • Wild CP, Shrestha SM, Anwar WA и Montesano R. (1992). Toxicol. Lett. , 64–65 (спец. №), 455–461.

  • Wild CP, Yin F, Turner PC, Chemin I, Chapot B, Mendy M, Whittle H, Kirk GD и Hall AJ. (2000). Внутр. J. Cancer , 86 , 1–7.

  • Wogan GN. (2000). Семин. Cancer Biol. , 10 , 201–210.

  • Wu TL, Zhang D, Chia JH, Tsao KH, Sun CF и Wu JT. (2002). Clin. Чим. Acta , 321 , 77–87.

  • Ян РК. (1989). Чжунхуа Бин Ли Сюэ За Чжи , 18 , 19–22.

  • Ян Х.И., Лу С.Н., Лиав Й.Ф., Ю С.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *